Borrelia burgdorferi Enolase Is a Surface-Exposed Plasminogen Binding Protein

Abstract

Borrelia burgdorferi is the causative agent of Lyme disease, the most commonly reported arthropod-borne disease in the United States. B. burgdorferi is a highly invasive bacterium, yet lacks extracellular protease activity. In order to aid in its dissemination, B. burgdorferi binds plasminogen, a component of the hosts' fibrinolytic system. Plasminogen bound to the surface of B. burgdorferi can then be activated to the protease plasmin, facilitating the bacterium's penetration of endothelial cell layers and degradation of extracellular matrix components. Enolases are highly conserved proteins with no sorting sequences or lipoprotein anchor sites, yet many bacteria have enolases bound to their outer surfaces. B. burgdorferi enolase is both a cytoplasmic and membrane associated protein. Enolases from other pathogenic bacteria are known to bind plasminogen. We confirmed the surface localization of B. burgdorferi enolase by in situ protease degradation assay and immunoelectron microscopy. We then demonstrated that B. burgdorferi enolase binds plasminogen in a dose-dependent manner. Lysine residues were critical for binding of plasminogen to enolase, as the lysine analog εaminocaproic acid significantly inhibited binding. Ionic interactions did not play a significant role in plasminogen binding by enolase, as excess NaCl had no effects on the interaction. Plasminogen bound to recombinant enolase could be converted to active plasmin. We conclude that B. burgdorferi enolase is a moonlighting cytoplasmic protein which also associates with the bacterial outer surface and facilitates binding to host plasminogen.

About the Authors:

Angela M. Floden

Affiliation: Departments of Microbiology and Immunology, University of North Dakota School of Medicine and Health Sciences, Grand Forks, North Dakota, United States of America

John A. Watt

Affiliation: Departments of Anatomy and Cell Biology, University of North Dakota School of Medicine and Health Sciences, Grand Forks, North Dakota, United States of America

Catherine A. Brissette

* E-mail: [email protected]

Affiliation: Departments of Microbiology and Immunology, University of North Dakota School of Medicine and Health Sciences, Grand Forks, North Dakota, United States of America

Introduction

Borrelia burgdorferi, the Lyme disease spirochete, causes the most common arthropod-borne disease in the United States and many other temperate regions of the world. Lyme disease is a significant cause of morbidity and it continues to be a serious public health concern [1]. Spirochetes such as B. burgdorferi are unique pathogens in that they lack classical virulence factors such as toxins. Instead, part of their remarkable ability to cause disease and suffering lies in their ability to widely disseminate throughout host tissues. B. burgdorferi lacks surface proteases that could degrade the hosts' extracellular matrix and accelerate the spirochete's penetration of host tissues. However, B. burgdorferi can usurp a host protease, plasminogen.

Plasminogen is a serine protease present in serum as an inactive proenzyme [2]. Plasminogen is converted by tissue-type plasminogen activator (tPA) or urokinase plasminogen activator (uPA) to active plasmin. Plasmin has a critical role in host fibrinolysis and extracellular matrix remodeling and therefore its activity is tightly controlled. Binding of plasminogen by mammalian plasminogen receptors is mediated by lysine-binding Kringle domains [3]. Binding of plasminogen to a mammalian receptor, fibrin clot, or a bacterial cell facilitates its activation to plasmin and makes the molecule less susceptible to inactivation by α2 antiplasmin [4], [5].

Many bacterial species are able to bind and use host plasminogen. B. burgdorferi is known to bind host plasminogen, which can then be converted to active plasmin. B. burgdorferi with bound plasmin is able to degrade fibronectin, penetrate the endothelium, and activate matrix metalloprotease-9 (MMP-9) and MMP-1 [6], [7], [8]. Plasminogen is required for efficient dissemination in ticks, and plasminogen deficient mice have decreased spirochetemia [9]. Several plasminogen-binding proteins have been identified and characterized in B. burgdorferi, including ErpA/C/P, OspA, OspC, and a 70 kDa plasminogen binding protein [10], [11], [12], [13].

Enolases are cytosolic metalloenzymes that catalyze the conversion of 2-phospho-D-glycerate to phosphoenolpyruvate [14]. Despite the lack of classical protein sorting machinery or cell membrane anchoring moieties, enolases are expressed on the surface of a variety of eukaryotic cells (including neuronal, cancer, epithelial, endothelial and hematopoietic cells), where they can function as plasminogen receptors [14]. Remarkably, enolases are also found on the surface of bacterial cells where they can similarly function as plasminogen receptors [4], [14], [15], [16].

While several plasminogen-binding proteins have been proposed and partially characterized for B. burgdorferi, we reasoned that the B. burgdorferi enolase might also be a plasminogen-binding protein. We now demonstrate that the B. burgdorferi enolase is exposed on the bacterial outer surface, and can bind host plasminogen.

Materials and Methods

Bacteria

Virulent Borrelia burgdorferi strain B31-MI-16 [17], [18], [19] was grown at 34°C to cell densities of approximately 1×107 ml in modified Barbour-Stoenner-Kelly II (BSK-II) medium [20]. Total DNA (chromosomal and plasmids) was isolated using the DNeasy blood and tissue kit (Qiagen, Valencia, CA) according to the manufacturer's instructions.

Recombinant proteins

Polyhistidine-tagged, full-length ErpC has been described previously [10], [21], [22]. All recombinant proteins contained amino-terminal tags. The enolase gene (ORF BB0337) plus approximately 500 bp upstream and downstream DNA, was produced by PCR of B. burgdorferi B31-MI-16 DNA using primers enoF flk 5′ tgcttgtgccatgaggaata and enoR flk 5′ ataaggcacggcatttcaag and subsequent cloning into pCR2.1 (Invitrogen, Carlsbad, CA). Full-length enolase for recombinant protein production was produced by PCR using primers enoF prot 5′caccatgggttttcacatttatgaaatca and enoR prot 5′ttatttttgtttaatagaataaaagacgctc and insertion into pET200 (Invitrogen). The resultant plasmid's insert was entirely sequenced on both strands to ensure that no undesired mutations had occurred during PCR or cloning procedures. Recombinant proteins were expressed in Escherichia coli Rosetta (DE3)pLysS (Novagen, Madison, WI), upon induction with isopropyl-β-D-thiogalactopyranoside (IPTG). Induced E. coli cells were harvested and then lysed by two passages through a French pressure cell at 1,000 p.s.i in a mixture of 30 mM imidazole, 0.5 M NaCl, and 20 mM NaPO4 (pH 7.4), and debris was cleared by centrifugation. Recombinant proteins were purified from cleared lysates using MagneHis nickel-conjugated magnetic beads (Promega, Madison, WI). All recombinant proteins were dialyzed overnight against phosphate-buffered saline (PBS) using 3,500 kDa molecular-weight-cutoff Slide-A-Lyzer cassettes (Pierce, Rockford, IL) at 4°C. Protein purity was assessed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) followed by staining with Coomassie brilliant blue. Protein concentrations were determined by bicinchoninic acid protein assays (BCA; Pierce).

SDS-PAGE and Western blotting

Fresh BSKII medium and spent BSKII medium from late log phase cultures of B. burgdorferi were centrifuged briefly (12,000 x g, 10 minutes) and the supernatants, recombinant enolase (1.25 µg/ml) or whole-cell lysate from log-phase B. burgdorferi (2×107 bacteria/ml) were separated by SDS-PAGE and proteins were either transferred to nitrocellulose membranes or stained with Coomassie brilliant blue. Membranes were blocked overnight at 4°C with 5% (w/v) non-fat dried milk in Tris-buffered saline-Tween 20 (TBS-T; 20 mM Tris (pH7.5), 150 mM NaCl, 0.05% (v/v) Tween 20). Membranes were next washed with TBS-T, and incubated for 2 h at room temperature with rabbit antiserum raised against human α-enolase (Pierce) diluted 1∶500 in TBS-T. After extensive washing with TBS-T, membranes were incubated for 1 h at room temperature with horseradish-peroxidase-conjugated donkey anti-rabbit IgG antibody (GE Healthcare, Piscataway, NJ), diluted 1: 20,000 in TBS-T. After a final series of washes with TBS-T, bound antibodies were detected using SuperSignal West Pico enhanced chemiluminescence substrate (Pierce).

In situ protease analysis

B. burgdorferi were grown to mid-exponential phase in BSK-II, pelleted by centrifugation, washed once with PBS, and resuspended in PBS to a final concentration of approximately 2×109 bacteria/ml. Examination of bacterial suspensions by darkfield microscopy did not indicate detectable lysis of the bacteria. Bacteria were then incubated at room temperature in PBS containing 40 µg of proteinase K (Fisher Scientific, Pittsburgh, PA) for 30, 60 or 120 minutes, whereupon digestion was terminated by addition of paramethylsulfonyl fluoride (PMSF; Sigma) to a final concentration of 1.6 mg/ml, followed by sample boiling. Control aliquots of bacteria were incubated in buffer for 2 h at room temperature without added protease, followed by the addition of inhibitor and boiling as with the protease-treated bacteria. Equal volumes of each bacterial lysate were subjected to SDS-PAGE and transferred to nitrocellulose membranes, and the susceptibility of enolase to protease digestion was assessed by immunoblot analysis with rabbit polyclonal anti-human α-enolase (Pierce) as described above. As experimental controls, lysates were also immunoblotted with monoclonal antibodies directed against OspC (located on the bacterial outer surface and thus susceptible to proteolysis [22], [23]) and FlaB (located in the periplasmic space and thus protected against protease digestion in intact bacteria [24]). Densitometric analysis was performed using ImageJ software (http://imageJ.nih.gov/ij).

Immunoelectron microscopy

For immunogold localization of enolase and OspC, cultures of B. burgdorferi were grown to mid-exponential phase then harvested by centrifugation and washed three times in sterile PBS, pH 7.4. TEM grids were washed repeatedly in PBS both before processing and between all incubation steps. All solutions were microfiltered using 0.4 µm syringe filters prior to use. Fifty microliter droplets containing non-diluted B. burgdorferi. were placed on the surface of parafilm covered plastic petri dishes. Gold 400 mesh formvar coated carbon-stabilized TEM grids (Ted Pella, Redding, CA) were then placed on each droplet for 90 mins at room temperature followed by a 20 minute fixation with buffered 4% paraformaldehyde. Sections were then incubated sequentially in the appropriate blocking buffer (4% normal serum/PBS, 1 hr. at room temperature), polyclonal rabbit anti-human α-enolase (1∶50 in blocking buffer, Pierce) or monoclonal mouse anti-OspC ([25] kind gift of Brian Stevenson), for 2 hours followed by biotinylated goat anti-rabbit or horse anti mouse IgG (1∶500 in blocking buffer, 2 hr.; Vector Laboratories, Burlingame, CA), respectively. This was followed by a 30 min incubation on droplets of streptavidin-conjugated 10 nm gold particles (Ted Pella). Grids were stabilized by post-fixation on droplets of 4% paraformaldehyde/2% glutaraldehyde for 10 minutes and washed repeatedly in PBS. To further assess specificity of the monoclonal anti-enolase antibody, additional spirochete grids were processed as described above with omission of the primary antibody. Grids were then counterstained by placing on droplets of a 5% molybdate solution for 60 seconds, washed repeatedly in PBS and viewed using a Hitachi 7500 transmission electron microscope.

ELISA

For the enzyme-linked immunosorbent assay (ELISA), Maxisorp 96- well plates (Nalge-Nunc, Rochester, NY) were coated overnight with 10 µg/ml human plasminogen (Sigma-Aldrich, St. Louis, MO), 10 µg/ml recombinant enolase, 10 µγ/ml recombinant ErpC (positive control for plasminogen binding), or 10 µg/ml bovine serum albumin (BSA [negative control]) in PBS at 4°C. Plates were brought to room temperature and washed once with PBS supplemented with 0.05% (vol/vol) Tween 20 (PBS-T). Wells were blocked for 2 h at room temperature with PBS with 1% (mass/vol) gelatin and then washed three times with PBS-T. Afterwards, 100 µl/well of either recombinant enolase, ErpC or plasminogen (Sigma-Aldrich) [see text for concentrations]) was added and incubated for 2 h at 37°C. Wells were washed three times with PBS-T and then incubated for 1 h at room temperature with rabbit antiserum raised against human α-enolase (which cross-reacts with the highly similar Borrelia burgdorferi protein; Pierce), diluted 1∶500 in PBS, or goat anti-human plasminogen (Novus Biologicals, Littleton, CO). Plates were washed three times with PBS-T, and then wells were incubated for 1 h at room temperature with horseradish peroxidase-conjugated anti-goat immunoglobulin G (IgG; Jackson Immunochemicals, West Grove, PA), horseradish peroxidase-conjugated anti-rabbit IgG (GE Healthcare), or horseradish peroxidase-conjugated protein G (Invitrogen), diluted 1∶5,000. Wells were again washed three times with PBS-T, 100 µl/well. Tetramethylbenzidine substrate (Thermo Scientific, Rockford, IL) was added, and then reactions were stopped by addition of 100 µl/well of 2 N H2SO4. Absorbance was read at 450 nm using a BioTek plate reader utilizing KC4 software (BioTek, Winooski, VT). To determine the role of lysines in plasminogen-enolase interaction, the lysine analog ε-aminocaproic acid (final concentration, 3–30 mM [Sigma-Aldrich]) was added with plasminogen to enolase-coated wells. Protein binding affinities (Kd) were calculated as that concentration of ligand required for half-maximal binding activity. For experiments examining the role of ionic interactions in enolase binding to plasminogen, increasing concentrations of NaCl were added to the PBS-based binding buffer with enolase. For experiments analyzing the ability of whole B. burgdorferi to bind recombinant enolase, plates were coated overnight with intact B. burgdorferi (2×107/ml; washed 3X in PBS); after washing and blocking with SeaBlock (Pierce) for 2 hours, recombinant B. burgdorferi enolase (0–50 µg/ml) was added for 2 hours at 37°C, plates washed, and enolase detected as described above.

Plasminogen activation assay

Maxisorp 96-well plates (Nalge-Nunc) were coated overnight with 10 µg/ml recombinant enolase or 10 µg/ml BSA in PBS at 4°C. Plates were brought to room temperature and washed once with PBS-T. Wells were blocked for 2 h at room temperature with PBS with 2% (mass/vol) BSA and then washed three times with PBS-T. Afterwards 100 µl/well of 10 µg/ml human plasminogen was added and incubated for 2 h at 37°C. Wells were washed three times with PBS-T, and then 4 ng/well of human uPA (Chemicon, Temecula, CA) was added. Next, the plasmin-specific substrate D-valyl-leucyl-lysine-p-nitroanilide dihydrochloride (Sigma-Aldrich) was added at a final concentration of 0.3 mM in 64 mM Tris, 350 mM NaCl, 0.15% Triton X-100 (pH 7.5). Plates were incubated overnight at 37°C, and absorbance was read at 405 nm.

Results

B. burgdorferi enolase is surface exposed

Enolases are highly conserved among organisms as diverse as bacteria and humans [14]. Alignment of enolases from diverse species suggested that an anti-human antibody might recognize B. burgdorferi enolase (Figure 1A). Notably, the amino acid residues required for binding the cofactor, manganese (165E, 206E, 339L), as well as the residues of the enzymatic active site (243D, 289E, 317D), were also conserved (Figure 1A and [27]). Recombinant B. burgdorferi enolase or whole cell lysate were separated by SDS-PAGE and transferred to nitrocellulose. As anticipated, an anti-human α-enolase polyclonal antibody recognized purified recombinant B. burgdorferi enolase as well as the native enolase in whole cell lysates (Figure 1B). Since the B. burgdorferi medium is rich in bovine serum albumin and rabbit serum, we confirmed that the medium itself was not recognized by the anti-human α-enolase antibody (Figure 1B, fresh BSK-II lane).

[Figure omitted. See PDF.]

Figure 1. Conservation of enolase.

(A) Alignment of enolases from mouse, human, yeast and B. burgdorferi. Dark shaded residues indicate identity; light gray residues indicate similarity. Arrows indicate the 3 conserved residues that make up the enzymatic active site; stars indicate the three conserved residues required for binding the cofactor manganese. (B) A rabbit polyclonal antiserum directed against human enolase recognizes enolase from B. burgdorferi. Top panel: Western blot; Bottom panel: Coomassie-stained SDS-PAGE gel. Molecular weight markers are indicated on the left. Lane 1: fresh BSKII medium; Lane 2: spent BSKII medium from late-log phase cultures of B. burgdorferi; Lane 3: B. burgdorferi cell lysate; Lane 4: recombinant enolase from B. burgdorferi.

https://doi.org/10.1371/journal.pone.0027502.g001

Despite the lack of canonical protein export sequences, enolases of many species, both bacteria and eukaryote, are localized on the cell surface [14], [16], [27], [28], [29], [30], [31], [32], [33], [34], [35]. The B. burgdorferi enolase was previously shown to fractionate with both the soluble and membrane fractions [36]. To address the possibility of surface exposure of enolase, in situ protease degradation assays were performed. Intact B. burgdorferi were incubated in the presence of proteinase K for 30, 60 or 120 minutes. Protease was then inactivated, bacteria were lysed and proteins separated by SDS-PAGE. After transfer to nitrocellulose membranes, blots were incubated with antisera specific for OspC, an outer surface protein, FlaB, a periplasmic protein, or enolase. As shown in Figure 2A, OspC was totally degraded, indicating surface exposure. FlaB was not affected by the protease, indicating that the bacteria were intact. There was a considerable reduction in the amount of enolase detected by 120 minutes of incubation with proteinase K, compared to the no protease control. Densitometric analysis of band intensities revealed a significant reduction in peak area between the 120-minute proteinase K treated band and the no protease control (Figure 2B). Although enolase is a glycolytic enzyme, and found within the cytoplasm, these data indicate that a proportion of B. burgdorferi enolase is also surface exposed.

[Figure omitted. See PDF.]

Figure 2. B. burgdorferi enolase is surface exposed.

(A) Demonstration of outer surface exposure of enolase by in situ protease degradation. Whole B. burgdorferi were incubated with proteinase K for 30, 60 or 120 minutes or 120 minutes in buffer with no protease. Proteases were then inactivated, bacteria were lysed, proteins were separated by SDS-PAGE, and the integrity of enolase, OspC (outer surface protein), and FlaB (periplasmic protein) were analyzed by immunoblot. Two separate protease degradation experiments were performed, with blots repeated 4 times. A representative blot is shown. (B) Densitometric analysis of in situ protease degradation immunoblots. Images from blots were scanned and peak areas for 120-minute proteinase K treatment and no protease control were assessed using ImageJ software (http://imageJ.nih.gov/ij). Data represent the means and standard errors from 4 separate blots. *, P = 0.03, Student's t test assuming unequal variances. (C) Binding of exogenous B. burgdorferi enolase to the surface of whole bacteria. Binding of B. burgdorferi enolase (0–50 µg/ml) to immobilized B. burgdorferi (2×107/ml) was analyzed by ELISA, with bound enolase detected by rabbit polyclonal antiserum directed against human enolase. Data represent the means and standard errors from three separate experiments with six replicates per enolase concentration.

https://doi.org/10.1371/journal.pone.0027502.g002

In Gram-positive bacteria such as Streptococcus pneumoniae, it has been suggested that autolysins are involved in liberating enolase from the bacterial cytoplasm, and that streptococci scavenge enolase from lysed neighbor cells [37], [38]. However, we were unable to detect enolase in spent culture medium from late log phase B. burgdorferi (Figure 1B, spent BSKII lane). In addition, we incubated intact B. burgdorferi (2×107 bacteria/ml) with recombinant B. burgdorferi enolase and assayed the amount of surface-associated enolase by ELISA. We did not detect any significant increase in surface-bound enolase compared to bacteria incubated in the absence of exogenous B. burgdorferi enolase (Figure 2C).

We then used immunoelectron microscopy to confirm the presence of enolase on the spirochete outer membrane. Our analysis revealed that gold-labeled anti-human α-enolase was scattered sporadically over the outer surface of the majority of spirochetes (Figure 3A). The density of labeling was quite variable cell-to-cell suggesting some variability in surface exposure of enolase among individual spirochetes. It is noteworthy that labeling was routinely observed on isolated patches of material resembling outer membrane (Figure 3A. asterisks). Omission of the anti-enolase antibody resulted in the complete absence of gold labeling on all control grids examined (Figure 3B). Antibody against an abundant outer surface protein, OspC, was used as a positive control. Anti-OspC labeling was generally denser than enolase, and tended to localize in large patches covering the surface of the spirochete (Figure 3C). The dense labeling of OspC is consistent with the presence of a well-preserved outer membrane and supports our data indicating the localization of enolase to the outer surface of B. burgdorferi.

[Figure omitted. See PDF.]

Figure 3. Immunoelectron microscopic analysis of B. burgdorferi enolase.

A) Anti-enolase was localized intermittently across the outer surface of B. burgdorferi (arrows). Gold particles were also observed on membrane blebs in proximity to the spirochete (asterisks). The boxed area in the inset indicates the region demonstrated in image (A). B) Omission of the primary antibody resulted in a complete loss of immunoreactivity. C) Anti-OspC immunolabeling demonstrated moderately heavy labeling on the outer surface of the spirochete (Arrows). Magnification bar  = 0.2 µm.

https://doi.org/10.1371/journal.pone.0027502.g003

Enolase binds human plasminogen

Previous studies have demonstrated that enolases of various gram-positive and gram-negative bacteria bind plasminogen (reviewed in [4]), and this prompted us to investigate whether the enolase of B. burgdorferi was capable of binding human plasminogen. Microtiter plates were coated with recombinant enolase, bovine serum albumin (negative control protein) or ErpC (a known B. burgdorferi plasminogen-binding protein [10]), and then plasminogen binding was assayed by ELISA. Enolase demonstrated significant binding of human plasminogen (Figure 4A). Analyses using various concentrations of recombinant enolase demonstrated that B. burgdorferi enolase bound plasminogen in a dose-dependent manner, with an apparent Kd of 125 nM (Figure 4B).

[Figure omitted. See PDF.]

Figure 4. B. burgdorferi enolase binds plasminogen.

(A) Binding of plasminogen (25 µg/ml) to immobilized proteins (10 µg/ml) was analyzed by ELISA, with bound plasminogen detected using specific antiserum. BSA was used as a negative control for nonspecific binding. ErpC is a known plasminogen binding protein of B. burgdorferi [10]. Data represent the means and standard errors from three separate experiments with six replicates per protein. ***, P<0.001, Student's t test assuming unequal variances. (B) Enolase binds plasminogen in a dose-dependent manner. Binding of plasminogen (10 µg/ml) to immobilized enolase (0–1 µM) was analyzed by ELISA, with bound plasminogen detected using specific antiserum. BSA was used as a negative control for nonspecific binding. Values represent plasminogen binding to enolase minus background absorbance for BSA. Data represent the means and standard errors from a representative experiment (1 of 4) with six replicates per concentration of enolase.

https://doi.org/10.1371/journal.pone.0027502.g004

Role of lysines in enolase-plasminogen binding

Plasminogen receptors, both mammalian and bacterial, often bind plasminogen through lysine residues that interact with the Kringle domains of plasminogen [14], [39], [40], [41]. The enolase of B. burgdorferi is comprised of 5.7% lysine residues. Addition of the lysine analog ε-aminocaproic acid significantly reduced the interaction between enolase and plasminogen, while the lysine analog had no effect on the background binding of plasminogen to BSA (Figure 5). These data indicate a role for lysines in enolase-plasminogen binding.

[Figure omitted. See PDF.]

Figure 5. Role of lysines in enolase/plasminogen binding activity.

Binding of plasminogen to immobilized enolase (10 µg/ml) was analyzed by ELISA. Plasminogen (25 µg/ml) was added to enolase-coated wells in the presence or absence of 0–30 mM ε-aminocaproic acid (lysine analog). Bound plasminogen was detected using a specific antiserum. BSA was used as a negative control. Data represent the means and standard errors from three separate experiments with 12 replicates per condition. ***, P<0.001, Student's t test assuming unequal variances.

https://doi.org/10.1371/journal.pone.0027502.g005

Role of ionic interactions in enolase-plasminogen binding

The enolase of B. burgdorferi is highly charged, with a theoretical pI of 5.38. To assess the role of ionic interactions in enolase binding of plasminogen, binding assays were performed in the presence of various concentrations of NaCl. NaCl at up to four times the normal physiological concentration had a small but insignificant negative effect on binding (Figure 6). These data suggest that ionic interactions are not required for the enolase-plasminogen interaction.

[Figure omitted. See PDF.]

Figure 6. Role of ionic interactions in enolase binding of plasminogen.

Binding of plasminogen to immobilized enolase (10 µg/ml) was analyzed by ELISA. Plasminogen (25 µg/ml) was incubated in the presence of increasing concentrations of NaCl. Bound plasminogen was detected using a specific antiserum. BSA was used as a negative control. Data are presented as % control (physiological NaCl, 150 mM) from the means and standard errors from three experiments with six replicates per concentration of NaCl.

https://doi.org/10.1371/journal.pone.0027502.g006

Plasminogen bound to enolase can be converted to active plasmin

B. burgdorferi-bound plasminogen is converted to plasmin [11]. To determine if enolase-bound plasminogen can also be converted to the active enzyme, microtiter plates were coated with enolase, blocked, plasminogen and the activator uPA were added, and proteolytic activity was quantified using a plasmin-specific chromogenic substrate. As shown in Figure 7, enolase-bound plasminogen was converted to active plasmin. These data suggest that, in vivo, enolase-bound plasminogen would be accessible to plasminogen activators.

[Figure omitted. See PDF.]

Figure 7. Enolase-bound plasminogen is converted into plasmin.

Enolase-coated wells of microtiter plates were incubated with plasminogen, urokinase (uPA), and/or a plasmin-specific chromogenic substrate. Proteolytic activity was measured by absorbance at 405 nM. Data represent the means and standard errors from three different experiments with six replicates per condition. ***, P<0.001 compared to the activation of plasminogen bound to the control protein, BSA, Student's t test assuming unequal variances.

https://doi.org/10.1371/journal.pone.0027502.g007

Discussion

Enolases belong to a class of proteins referred to as moonlighting proteins: proteins that have multiple functions and often exist in distinct locations within a cell [42]. Along with its role as an essential glycolytic enzyme, we have demonstrated that B. burgdorferi enolase has an additional function as a cell-surface plasminogen receptor. Enolases lack traditional sorting signals and how these proteins become surface exposed is unknown. The enolase of B. burgdorferi is both cytoplasmic and surface exposed (Figures 2 and 3, and [36]), and humans and animals produce antibodies to the B. burgdorferi enolase during natural infection [43]. Proteins destined for the outer surface are expensive for a cell to produce [44], and the amino acid sequence of enolase certainly suggests an inexpensive protein. The B. burgdorferi protein, like many enolases, is rich in “cheap” amino acids such as alanine (8.3%) and glycine (7.2%) while low in ‘expensive’ amino acids such as phenylalanine (3.9%) and tryptophan (1.3%). Intriguingly, a hydrophobic domain in human αenolase suggested to play a role in its membrane association (AAVPSGASTGI) is identical in the B. burgdorferi enolase [14]. It is clear, however, that for both eukaryotic and bacterial enolases, surface exposure is not unusual [16], [27], [28], [29], [30], [32], [33], [34], [35], [45]. Other cytoplasmic proteins, such as DnaK, have also been identified as plasminogen-binding proteins [46], [47].

A potential consequence of the surface exposure of the B. burgdorferi enolase is its possible contribution to autoimmunity. Streptococcal enolases are cross-reactive with human enolase and are thought to play a role in post-streptococcal sequelae such as rheumatic heart disease [48]. Eukaryotic enolases are also associated with autoimmune conditions. The identified cross-reactive epitopes in cancer-associated retinopathy (FRAAVPSG and RYMGKGVS) are almost identical to the residues present in the B. burgdorferi enolase [49].

Lysine residues play a critical role in the interaction of plasminogen receptors with their ligand. A number of bacterial plasminogen-binding proteins contain essential lysines [4], [6], [10], [50]. The lysine analog ε-aminocaproic acid significantly inhibited enolase binding to plasminogen. For many plasminogen receptors, it is the C-terminal lysines that are critical for binding [16], [39]. The lysine residues in B. burgdorferi enolase, however, are dispersed. Internal plasminogen binding sites have been identified for other pathogen's receptors [51], [52], [53]. We are continuing to define the plasminogen-binding site(s) of the B. burgdorferi enolase.

Plasminogen binding by B. burgdorferi is clearly important in vivo.

Plasminogen-deficient mice exhibit reduced spirochetemia, and plasminogen is required for efficient dissemination of B. burgdorferi within the tick vector [9]. B. burgdorferi-bound plasminogen can degrade extracellular matrix proteins and activate matrix metalloproteases, facilitating the spirochete's spread through host tissues [6], [7], [8]. Interestingly, B. burgdorferi upregulates expression of both the plasminogen activator uPA and the plasmin inhibitor PAI-2 from monocytes. The upregulation of uPA could activate plasminogen bound to the surface of B. burgdorferi. The upregulation of PAI-2 had no effect on B. burgdorferi transmigration but did decrease monocyte migration across Matrigel [54]. In addition to the suppression of leukocyte function, B. burgdorferi may capitalize on plasminogen binding for other immune evasive strategies. For instance, binding of plasminogen is anti-opsonic for Staphylococcus aureus, and the enolase of Streptococcus sobrinus increases IL-10 expression in mice [55], [56].

It is not surprising that B. burgdorferi may express multiple plasminogen-binding proteins on its surface [10], [11], [12], [13]. Redundancy in bacterial adhesins is not unusual. Indeed, B. burgdorferi possesses at least three distinct fibronectin-binding proteins [57], [58], [59]. Many bacterial pathogens possess both high and low-affinity plasminogen-binding proteins on their cell surface [60], [61]. The B. burgdorferi plasminogen-binding protein ErpP, for instance, has a Kd of ∼25 nM, while we calculate that the enolase has a Kd of ∼125 nM (Figure 4B, and [10]. In addition, B. burgdorferi may utilize different plasminogen-binding receptors at different stages in its infectious life cycle, i.e., tick versus mammal. Plasminogen binding may not be the only function of extracellular enolase; the enolase of S. aureus binds laminin, and LenA, a surface receptor of Leptospira interrogans, interacts with plasminogen, complement Factor H, and laminin [26], [31], [62]. The plasminogen-binding OspA protein of B. burgdorferi also functions in invasion of the tick salivary glands, and ErpP of B. burgdorferi binds both plasminogen and complement factor H [10], [63].

B. burgdorferi is a successful extracellular pathogen that co-opts host proteins for its own advantage. We have identified that the enolase of B. burgdorferi moonlights as a surface-exposed, plasminogen-binding protein.

Acknowledgments

The authors thank Amy Bowman for technical assistance, and Brian Stevenson and Ann Flower for helpful discussion.

Author Contributions

Conceived and designed the experiments: CAB. Performed the experiments: CAB AMF JAW. Analyzed the data: CAB AMF JAW. Contributed reagents/materials/analysis tools: CAB JAW. Wrote the paper: AMF CAB.

Citation: Floden AM, Watt JA, Brissette CA (2011) Borrelia burgdorferi Enolase Is a Surface-Exposed Plasminogen Binding Protein. PLoS ONE6(11): e27502. https://doi.org/10.1371/journal.pone.0027502

References

1. CDC (2011) Summary of notifiable diseases – United States, 2009. Morb Mortal Wkly Rep 58: 1–100.CDC2011Summary of notifiable diseases – United States, 2009.Morb Mortal Wkly Rep581100

2. Sun H (2006) The interaction between pathogens and the host coagulation system. Physiology 21: 281–288.H. Sun2006The interaction between pathogens and the host coagulation system.Physiology21281288

3. Wiman B, Lijnen HR, Collen D (1979) On the specific interaction between the lysine-binding sites in plasmin and complementary sites in alpha2-antiplasmin and in fibrinogen. Biochem Biophys Acta 579: 142–154.B. WimanHR LijnenD. Collen1979On the specific interaction between the lysine-binding sites in plasmin and complementary sites in alpha2-antiplasmin and in fibrinogen.Biochem Biophys Acta579142154

4. Lahteenmaki K, Kuusela P, Korhonen TK (2001) Bacterial plasminogen activators and receptors. FEMS Microbiol Rev 25: 531–552.K. LahteenmakiP. KuuselaTK Korhonen2001Bacterial plasminogen activators and receptors.FEMS Microbiol Rev25531552

5. Lottenberg R, Broder CC, Boyle MD (1987) Identification of a specific receptor for plasmin on a group A streptococcus. Infect Immun 55: 1914–1918.R. LottenbergCC BroderMD Boyle1987Identification of a specific receptor for plasmin on a group A streptococcus.Infect Immun5519141918

6. Coleman JL, Roemer EJ, Benach JL (1999) Plasmin-coated Borrelia burgdorferi degrades soluble and insoluble components of the mammalian extracellular matrix. Infect Immun 67: 3929–3936.JL ColemanEJ RoemerJL Benach1999Plasmin-coated Borrelia burgdorferi degrades soluble and insoluble components of the mammalian extracellular matrix.Infect Immun6739293936

7. Coleman JL, Sellati TJ, Testa JE, Kew RR, Furie MB, et al. (1995) Borrelia burgdorferi binds plasminogen, resulting in enhanced penetration of endothelial monolayers. Infect Immun 63: 2478–2484.JL ColemanTJ SellatiJE TestaRR KewMB Furie1995Borrelia burgdorferi binds plasminogen, resulting in enhanced penetration of endothelial monolayers.Infect Immun6324782484

8. Gebbia JA, Coleman JL, Benach JL (2001) Borrelia spirochetes upregulate release and activation of matrix metalloproteinase gelatinase B (MMP-9) and collagenase 1 (MMP-1) in human cells. Infect Immun 69: 456–462.JA GebbiaJL ColemanJL Benach2001Borrelia spirochetes upregulate release and activation of matrix metalloproteinase gelatinase B (MMP-9) and collagenase 1 (MMP-1) in human cells.Infect Immun69456462

9. Coleman JL, Gebbia JA, Piesman J, Degen JL, Bugge TH, et al. (1997) Plasminogen is required for efficient dissemination of B. burgdorferi in ticks and for enhancement of spirochetemia in mice. Cell 89: 1111–1119.JL ColemanJA GebbiaJ. PiesmanJL DegenTH Bugge1997Plasminogen is required for efficient dissemination of B. burgdorferi in ticks and for enhancement of spirochetemia in mice.Cell8911111119

10. Brissette CA, Haupt K, Barthel D, Cooley AE, Bowman A, et al. (2009) The Borrelia burgdorferi infection-associated surface proteins ErpP, ErpA, and ErpC bind human plasminogen. Infect Immun 77: 300–306.CA BrissetteK. HauptD. BarthelAE CooleyA. Bowman2009The Borrelia burgdorferi infection-associated surface proteins ErpP, ErpA, and ErpC bind human plasminogen.Infect Immun77300306

11. Fuchs H, Wallich R, Simon MM, Kramer MD (1994) The outer surface protein A of the spirochete Borrelia burgdorferi is a plasmin(ogen) receptor. Proc Natl Acad Sci U S A 91: 12594–12598.H. FuchsR. WallichMM SimonMD Kramer1994The outer surface protein A of the spirochete Borrelia burgdorferi is a plasmin(ogen) receptor.Proc Natl Acad Sci U S A911259412598

12. Hu LT, Pratt SD, Perides G, Katz L, Rogers RA, et al. (1997) Isolation, cloning and expression of a 70-kilodalton plasminogen binding protein of Borrelia burgdorferi. Infect Immun 65: 4989–4995.LT HuSD PrattG. PeridesL. KatzRA Rogers1997Isolation, cloning and expression of a 70-kilodalton plasminogen binding protein of Borrelia burgdorferi.Infect Immun6549894995

13. Lagal V, Portnoi D, Faure G, Postic D, Baranton G (2006) Borrelia burgdorferi sensu stricto invasiveness is correlated with OspC-plasminogen affinity. Microbes Infect 8: 645–652.V. LagalD. PortnoiG. FaureD. PosticG. Baranton2006Borrelia burgdorferi sensu stricto invasiveness is correlated with OspC-plasminogen affinity.Microbes Infect8645652

14. Pancholi V (2001) Multifunctional alpha-enolase: its role in diseases. Cell Mol Life Sci 58: 902–920.V. Pancholi2001Multifunctional alpha-enolase: its role in diseases.Cell Mol Life Sci58902920

15. Lahteenmaki K, Edelman S, Korhonen TK (2005) Bacterial metastasis: the host plasminogen system in bacterial invasion. Trends Microbiol 13: 79–85.K. LahteenmakiS. EdelmanTK Korhonen2005Bacterial metastasis: the host plasminogen system in bacterial invasion.Trends Microbiol137985

16. Pancholi V, Fischetti VA (1998) alpha-enolase, a novel strong plasmin(ogen) binding protein on the surface of pathogenic streptococci. J Biol Chem 273: 14503–14515.V. PancholiVA Fischetti1998alpha-enolase, a novel strong plasmin(ogen) binding protein on the surface of pathogenic streptococci.J Biol Chem2731450314515

17. Casjens S, Palmer N, van Vugt R, Huang WM, Stevenson B, et al. (2000) A bacterial genome in flux: the twelve linear and nine circular extrachromosomal DNAs of an infectious isolate of the Lyme disease spirochete Borrelia burgdorferi. Mol Microbiol 35: 490–516.S. CasjensN. PalmerR. van VugtWM HuangB. Stevenson2000A bacterial genome in flux: the twelve linear and nine circular extrachromosomal DNAs of an infectious isolate of the Lyme disease spirochete Borrelia burgdorferi.Mol Microbiol35490516

18. Fraser CM, Casjens S, Huang WM, Sutton GG, Clayton R, et al. (1997) Genomic sequence of a Lyme disease spirochaete, Borrelia burgdorferi. Nature 390: 580–586.CM FraserS. CasjensWM HuangGG SuttonR. Clayton1997Genomic sequence of a Lyme disease spirochaete, Borrelia burgdorferi.Nature390580586

19. Miller JC, von Lackum K, Babb K, McAlister JD, Stevenson B (2003) Temporal analysis of Borrelia burgdorferi Erp protein expression throughout the mammal-tick infectious cycle. Infect Immun 71: 6943–6952.JC MillerK. von LackumK. BabbJD McAlisterB. Stevenson2003Temporal analysis of Borrelia burgdorferi Erp protein expression throughout the mammal-tick infectious cycle.Infect Immun7169436952

20. Zückert WR (2007) Laboratory maintenance of Borrelia burgdorferi. In: Coico RT, Kowalik TF, Quarles J, Stevenson B, Taylor R, editors. Current Protocols In Microbiology. Hoboken, N.J.: J. Wiley and Sons. pp. 12C.11.11–12C.11.10.WR Zückert2007Laboratory maintenance of Borrelia burgdorferi.RT CoicoTF KowalikJ. QuarlesB. StevensonR. TaylorCurrent Protocols In MicrobiologyHoboken, N.J.J. Wiley and Sons12C.11.1112C.11.10

21. Stevenson B, Bono JL, Schwan TG, Rosa P (1998) Borrelia burgdorferi Erp proteins are immunogenic in mammals infected by tick bite, and their synthesis is inducible in cultured bacteria. Infect Immun 66: 2648–2654.B. StevensonJL BonoTG SchwanP. Rosa1998Borrelia burgdorferi Erp proteins are immunogenic in mammals infected by tick bite, and their synthesis is inducible in cultured bacteria.Infect Immun6626482654

22. El-Hage N, Babb K, Carroll JA, Lindstrom N, Fischer ER, et al. (2001) Surface exposure and protease insensitivity of Borrelia burgdorferi Erp (OspEF-related) lipoproteins. Microbiology 147: 821–830.N. El-HageK. BabbJA CarrollN. LindstromER Fischer2001Surface exposure and protease insensitivity of Borrelia burgdorferi Erp (OspEF-related) lipoproteins.Microbiology147821830

23. Fuchs R, Jauris S, Lottspeich F, Preac-Mursic V, Wilske B, et al. (1992) Molecular analysis and expression of a Borrelia burgdorferi gene encoding a 22 kDa protein (pC) in Escherichia coli. Mol Microbiol 6: 503–509.R. FuchsS. JaurisF. LottspeichV. Preac-MursicB. Wilske1992Molecular analysis and expression of a Borrelia burgdorferi gene encoding a 22 kDa protein (pC) in Escherichia coli.Mol Microbiol6503509

24. Holt SC (1978) Anatomy and chemistry of spirochetes. Microbiol Rev 42: 114–160.SC Holt1978Anatomy and chemistry of spirochetes.Microbiol Rev42114160

25. Mbow ML, Gilmore RD Jr, Stevenson B, Golde WT, Piesman J, et al. (2002) Borrelia burgdorferi-specific monoclonal antibodies derived from mice primed with Lyme disease spirochete-infected Ixodes scapularis ticks. Hybrid Hybridomics 21: 179–182.ML MbowRD Gilmore JrB. StevensonWT GoldeJ. Piesman2002Borrelia burgdorferi-specific monoclonal antibodies derived from mice primed with Lyme disease spirochete-infected Ixodes scapularis ticks.Hybrid Hybridomics21179182

26. Stevenson B, Choy HA, Pinne M, Rotondi ML, Miller MC, et al. (2007) Leptospira interrogans endostatin-like outer membrane proteins bind host fibronectin, laminin and regulators of complement. PLoS ONE 2: e1188.B. StevensonHA ChoyM. PinneML RotondiMC Miller2007Leptospira interrogans endostatin-like outer membrane proteins bind host fibronectin, laminin and regulators of complement.PLoS ONE2e1188

27. Feng Y, Pan X, Sun W, Wang C, Zhang H, et al. (2009) Streptococcus suis enolase functions as a protective antigen displayed on the bacterial cell surface. J Infect Dis 200: 1583–1592.Y. FengX. PanW. SunC. WangH. Zhang2009Streptococcus suis enolase functions as a protective antigen displayed on the bacterial cell surface.J Infect Dis20015831592

28. Agarwal S, Kulshreshtha P, Bambah Mukku D, Bhatnagar R (2008) alpha-Enolase binds to human plasminogen on the surface of Bacillus anthracis. Biochim Biophys Acta 1784: 986–994.S. AgarwalP. KulshreshthaD. Bambah MukkuR. Bhatnagar2008alpha-Enolase binds to human plasminogen on the surface of Bacillus anthracis.Biochim Biophys Acta1784986994

29. Bergmann S, Rohde M, Chhatwal GS, Hammerschmidt S (2001) alpha-Enolase of Streptococcus pneumoniae is a plasmin(ogen)-binding protein displayed on the bacterial cell surface. Mol Microbiol 40: 1273–1287.S. BergmannM. RohdeGS ChhatwalS. Hammerschmidt2001alpha-Enolase of Streptococcus pneumoniae is a plasmin(ogen)-binding protein displayed on the bacterial cell surface.Mol Microbiol4012731287

30. Candela M, Biagi E, Centanni M, Turroni S, Vici M, et al. (2009) Bifidobacterial enolase, a cell surface receptor for human plasminogen involved in the interaction with the host. Microbiology 155: 3294–3303.M. CandelaE. BiagiM. CentanniS. TurroniM. Vici2009Bifidobacterial enolase, a cell surface receptor for human plasminogen involved in the interaction with the host.Microbiology15532943303

31. Carneiro CR, Postol E, Nomizo R, Reis LF, Brentani RR (2004) Identification of enolase as a laminin-binding protein on the surface of Staphylococcus aureus. Microbes Infect 6: 604–608.CR CarneiroE. PostolR. NomizoLF ReisRR Brentani2004Identification of enolase as a laminin-binding protein on the surface of Staphylococcus aureus.Microbes Infect6604608

32. Hara H, Ohta H, Inoue T, Ohashi T, Takashiba S, et al. (2000) Cell surface-associated enolase in Actinobacillus actinomycetemcomitans. Microbiol Immunol 44: 349–356.H. HaraH. OhtaT. InoueT. OhashiS. Takashiba2000Cell surface-associated enolase in Actinobacillus actinomycetemcomitans.Microbiol Immunol44349356

33. Sha J, Erova TE, Alyea RA, Wang S, Olano JP, et al. (2009) Surface-expressed enolase contributes to the pathogenesis of clinical isolate SSU of Aeromonas hydrophila. J Bacteriol 191: 3095–3107.J. ShaTE ErovaRA AlyeaS. WangJP Olano2009Surface-expressed enolase contributes to the pathogenesis of clinical isolate SSU of Aeromonas hydrophila.J Bacteriol19130953107

34. Moscato S, Pratesi F, Sabbatini A, Chimenti D, Scavuzzo M, et al. (2000) Surface expression of a glycolytic enzyme, alpha-enolase, recognized by autoantibodies in connective tissue disorders. Eur J Immunol 30: 3575–3584.S. MoscatoF. PratesiA. SabbatiniD. ChimentiM. Scavuzzo2000Surface expression of a glycolytic enzyme, alpha-enolase, recognized by autoantibodies in connective tissue disorders.Eur J Immunol3035753584

35. Pal-Bhowmick I, Mehta M, Coppens I, Sharma S, Jarori GK (2007) Protective properties and surface localization of Plasmodium falciparum enolase. Infect Immun 75: 5500–5508.I. Pal-BhowmickM. MehtaI. CoppensS. SharmaGK Jarori2007Protective properties and surface localization of Plasmodium falciparum enolase.Infect Immun7555005508

36. Nowalk AJ, Nolder C, Clifton DR, Carroll JA (2006) Comparative proteome analysis of subcellular fractions from Borrelia burgdorferi by NEPHGE and IPG. Proteomics 6: 2121–2134.AJ NowalkC. NolderDR CliftonJA Carroll2006Comparative proteome analysis of subcellular fractions from Borrelia burgdorferi by NEPHGE and IPG.Proteomics621212134

37. Jedrzejas MJ (2001) Pneumococcal virulence factors: structure and function. Microbiol Mol Biol Rev 65: 187–207.MJ Jedrzejas2001Pneumococcal virulence factors: structure and function.Microbiol Mol Biol Rev65187207

38. Guiral S, Mitchell TJ, Martin B, Claverys JP (2005) Competence-programmed predation of noncompetent cells in the human pathogen Streptococcus pneumoniae: genetic requirements. Proc Natl Acad Sci U S A 102: 8710–8715.S. GuiralTJ MitchellB. MartinJP Claverys2005Competence-programmed predation of noncompetent cells in the human pathogen Streptococcus pneumoniae: genetic requirements.Proc Natl Acad Sci U S A10287108715

39. Miles LA, Dahlberg CM, Plescia J, Felez J, Kato K, et al. (1991) Role of cell-surface lysines in plasminogen binding to cells: identification of alpha-enolase as a candidate plasminogen receptor. Biochemistry 30: 1682–1691.LA MilesCM DahlbergJ. PlesciaJ. FelezK. Kato1991Role of cell-surface lysines in plasminogen binding to cells: identification of alpha-enolase as a candidate plasminogen receptor.Biochemistry3016821691

40. Plow EF, Herren T, Redlitz A, Miles LA, Hoover-Plow JL (1995) The cell biology of the plasminogen system. FASEB J 9: 939–945.EF PlowT. HerrenA. RedlitzLA MilesJL Hoover-Plow1995The cell biology of the plasminogen system.FASEB J9939945

41. Castellino FJ, McCance SG (1997) The kringle domains of human plasminogen. Ciba Found Symp 212: 46–60.FJ CastellinoSG McCance1997The kringle domains of human plasminogen.Ciba Found Symp2124660

42. Jeffery CJ (1999) Moonlighting proteins. Trends Biochem Sci 24: 8–11.CJ Jeffery1999Moonlighting proteins.Trends Biochem Sci24811

43. Barbour AG, Jasinskas A, Kayala MA, Davies DH, Steere AC, et al. (2008) A genome-wide proteome array reveals a limited set of immunogens in natural infections of humans and white-footed mice with Borrelia burgdorferi. Infect Immun 76: 3374–3389.AG BarbourA. JasinskasMA KayalaDH DaviesAC Steere2008A genome-wide proteome array reveals a limited set of immunogens in natural infections of humans and white-footed mice with Borrelia burgdorferi.Infect Immun7633743389

44. Smith DR, Chapman MR (2010) Economical evolution: microbes reduce the synthetic cost of extracellular proteins. mBio 1: 1–9.DR SmithMR Chapman2010Economical evolution: microbes reduce the synthetic cost of extracellular proteins.mBio119

45. Eroles P, Sentandreu M, Elorza MV, Sentandreu R (1997) The highly immunogenic enolase and Hsp70p are adventitious Candida albicans cell wall proteins. Microbiology 143(Pt 2): 313–320.P. ErolesM. SentandreuMV ElorzaR. Sentandreu1997The highly immunogenic enolase and Hsp70p are adventitious Candida albicans cell wall proteins.Microbiology143Pt 2313320

46. Kunert A, Losse J, Gruszin C, Huhn M, Kaendler K, et al. (2007) Immune evasion of the human pathogen Pseudomonas aeruginosa: elongation factor Tuf is a factor H and plasminogen binding protein. J Immunol 179: 2979–2988.A. KunertJ. LosseC. GruszinM. HuhnK. Kaendler2007Immune evasion of the human pathogen Pseudomonas aeruginosa: elongation factor Tuf is a factor H and plasminogen binding protein.J Immunol17929792988

47. Xolalpa W, Vallecillo AJ, Lara M, Mendoza-Hernandez G, Comini M, et al. (2007) Identification of novel bacterial plasminogen-binding proteins in the human pathogen Mycobacterium tuberculosis. Proteomics 7: 3332–3341.W. XolalpaAJ VallecilloM. LaraG. Mendoza-HernandezM. Comini2007Identification of novel bacterial plasminogen-binding proteins in the human pathogen Mycobacterium tuberculosis.Proteomics733323341

48. Fontan PA, Pancholi V, Nociari MM, Fischetti VA (2000) Antibodies to streptococcal surface enolase react with human alpha-enolase: implications in poststreptococcal sequelae. J Infect Dis 182: 1712–1721.PA FontanV. PancholiMM NociariVA Fischetti2000Antibodies to streptococcal surface enolase react with human alpha-enolase: implications in poststreptococcal sequelae.J Infect Dis18217121721

49. Adamus G, Amundson D, Seigel GM, Machnicki M (1998) Anti-enolase-alpha autoantibodies in cancer-associated retinopathy: epitope mapping and cytotoxicity on retinal cells. J Autoimmun 11: 671–677.G. AdamusD. AmundsonGM SeigelM. Machnicki1998Anti-enolase-alpha autoantibodies in cancer-associated retinopathy: epitope mapping and cytotoxicity on retinal cells.J Autoimmun11671677

50. Boyle MD, Lottenberg R (1997) Plasminogen activation by invasive human pathogens. Thromb Haemost 77: 1–10.MD BoyleR. Lottenberg1997Plasminogen activation by invasive human pathogens.Thromb Haemost77110

51. Bergmann S, Wild D, Diekmann O, Frank R, Bracht D, et al. (2003) Identification of a novel plasmin(ogen)-binding motif in surface displayed alpha-enolase of Streptococcus pneumoniae. Mol Microbiol 49: 411–423.S. BergmannD. WildO. DiekmannR. FrankD. Bracht2003Identification of a novel plasmin(ogen)-binding motif in surface displayed alpha-enolase of Streptococcus pneumoniae.Mol Microbiol49411423

52. Ehinger S, Schubert WD, Bergmann S, Hammerschmidt S, Heinz DW (2004) Plasmin(ogen)-binding alpha-enolase from Streptococcus pneumoniae: crystal structure and evaluation of plasmin(ogen)-binding sites. J Mol Biol 343: 997–1005.S. EhingerWD SchubertS. BergmannS. HammerschmidtDW Heinz2004Plasmin(ogen)-binding alpha-enolase from Streptococcus pneumoniae: crystal structure and evaluation of plasmin(ogen)-binding sites.J Mol Biol3439971005

53. Knaust A, Weber MV, Hammerschmidt S, Bergmann S, Frosch M, et al. (2007) Cytosolic proteins contribute to surface plasminogen recruitment of Neisseria meningitidis. J Bacteriol 189: 3246–3255.A. KnaustMV WeberS. HammerschmidtS. BergmannM. Frosch2007Cytosolic proteins contribute to surface plasminogen recruitment of Neisseria meningitidis.J Bacteriol18932463255

54. Haile WB, Coleman JL, Benach JL (2006) Reciprocal upregulation of urokinase plasminogen activator and its inhibitor, PAI-2, by Borrelia burgdorferi affects bacterial penetration and host-inflammatory response. Cell Microbiol 8: 1349–1360.WB HaileJL ColemanJL Benach2006Reciprocal upregulation of urokinase plasminogen activator and its inhibitor, PAI-2, by Borrelia burgdorferi affects bacterial penetration and host-inflammatory response.Cell Microbiol813491360

55. Veiga-Malta I, Duarte M, Dinis M, Tavares D, Videira A, et al. (2004) Enolase from Streptococcus sobrinus is an immunosuppressive protein. Cell Microbiol 6: 79–88.I. Veiga-MaltaM. DuarteM. DinisD. TavaresA. Videira2004Enolase from Streptococcus sobrinus is an immunosuppressive protein.Cell Microbiol67988

56. Rooijakkers SH, van Wamel WJ, Ruyken M, van Kessel KP, van Strijp JA (2005) Anti-opsonic properties of staphylokinase. Microbes Infect 7: 476–484.SH RooijakkersWJ van WamelM. RuykenKP van KesselJA van Strijp2005Anti-opsonic properties of staphylokinase.Microbes Infect7476484

57. Brissette CA, Bykowski T, Cooley AE, Bowman A, Stevenson B (2009) Borrelia burgdorferi RevA antigen binds host fibronectin. Infect Immun 77: 2802–2812.CA BrissetteT. BykowskiAE CooleyA. BowmanB. Stevenson2009Borrelia burgdorferi RevA antigen binds host fibronectin.Infect Immun7728022812

58. Probert WS, Johnson BJB (1998) Identification of a 47 kDA fibronectin-binding protein expressed by Borrelia burgdorferi isolate B31. Mol Microbiol 30: 1003–1015.WS ProbertBJB Johnson1998Identification of a 47 kDA fibronectin-binding protein expressed by Borrelia burgdorferi isolate B31.Mol Microbiol3010031015

59. Seshu J, Esteve-Gassent MD, Labandeira-Rey M, Kim JH, Trzeciakowski JP, et al. (2006) Inactivation of the fibronectin-binding adhesin gene bbk32 significantly attenuates the infectivity potential of Borrelia burgdorferi. Mol Microbiol 59: 1591–1601.J. SeshuMD Esteve-GassentM. Labandeira-ReyJH KimJP Trzeciakowski2006Inactivation of the fibronectin-binding adhesin gene bbk32 significantly attenuates the infectivity potential of Borrelia burgdorferi.Mol Microbiol5915911601

60. Berge A, Sjobring U (1993) PAM, a novel plasminogen-binding protein from Streptococcus pyogenes. J Biol Chem 268: 25417–25424.A. BergeU. Sjobring1993PAM, a novel plasminogen-binding protein from Streptococcus pyogenes.J Biol Chem2682541725424

61. Ullberg M, Kronvall G, Karlsson I, Wiman B (1990) Receptors for human plasminogen on gram-negative bacteria. Infect Immun 58: 21–25.M. UllbergG. KronvallI. KarlssonB. Wiman1990Receptors for human plasminogen on gram-negative bacteria.Infect Immun582125

62. Verma A, Brissette CA, Bowman AA, Shah ST, Zipfel PF, et al. (2010) Leptospiral endostatin-like protein A is a bacterial cell surface receptor for human plasminogen. Infect Immun 78: 2053–2059.A. VermaCA BrissetteAA BowmanST ShahPF Zipfel2010Leptospiral endostatin-like protein A is a bacterial cell surface receptor for human plasminogen.Infect Immun7820532059

63. Pal U, Yang X, Chen M, Bockenstedt LK, Anderson JF, et al. (2004) OspC facilitates Borrelia burgdorferi invasion of Ixodes scapularis salivary glands. J Clin Invest 113: 220–230.U. PalX. YangM. ChenLK BockenstedtJF Anderson2004OspC facilitates Borrelia burgdorferi invasion of Ixodes scapularis salivary glands.J Clin Invest113220230