1. Introduction
Chinese cabbage belongs to the Cruciferae family that originated in China [1], which has become one of the essential economic vegetable crops and is widely cultivated around the globe [2,3]. Over the past two decades, heavy metals have been considered a severe environmental threat to all living organisms, such as plants, animals and humans [4]. Global population has shown an intensive increment due to industrialization, during which excessive amounts of heavy metal pollutions such as mercury (Hg), cadmium (Cd), chromium (Cr), aluminum (Al), arsenic (As) and lead (Pb) have been produced [5,6]. Among these heavy metals, Hg is highly toxic even under low concentrations [6]. In plants, there are no specific channels to absorb and transport Hg from the root to the shoot [4,7]. The excessive accumulation of Hg causes physiological and biochemical disorders and decreases plant productivity [8,9,10]. Moreover, the uptake of Hg by the plant can be transferred to the human body, leading to numerous chronic disorders such as skin cancer, heart problems and lung diseases [10,11].
Hg accumulation is influenced by soil Hg contamination in plants, which is absorbed through the root system and translocated to the shoot [12]. The enhanced accumulation of Hg increases ROS production; reduces the activities of antioxidant enzymes; decreases the production of nutrients, hormones and pigments; and negatively affects photosynthetic capacity [11,12]. A previous study reported that Hg accumulation in plants might stimulate the production of ROS, which leads to damage to proteins and membrane lipids [11]. The overproduction of ROS can influence the activities of essential enzymes such as GSH, SOD, POD, CAT, APX and GR [12]. The GR enzyme is highly sensitive to Hg stress and significantly reduced in alfalfa roots [4,11,13,14]. Hg stress damages root activities, interrupts water and nutrient absorption and reduces uptake capacity from the root to the shoot [11]. Hg stress also shows a great effect on chlorophyll contents, photosynthesis and plant production [6]. Therefore, it is crucial to investigate Hg stress and identify candidate genes that are potentially involved in Hg stress tolerance.
Plant cytochrome (CYP) 450s are the most prominent enzyme family, which is widely involved in NADPH/O2-defendant hydroxylation reactions in plants [14]. In addition, the CYP genes play a fundamental role in the biosynthesis of secondary metabolites, phytohormones and antioxidants in plants [15]. CYPs have been reported to play an essential role in plant hormone biosynthesis and signaling pathways, while these hormones are potentially involved in plant abiotic stress responses, such as high and low temperature, drought, salinity and heavy metal stress [14,16]. Up to now, millions of CYP genes have been identified in different species, and about 16,000 genes have been reported in plant species [14]. A number of CYP genes have shown significant responses to abiotic stresses, exhibiting great potential to overcome plant resilience to environmental influences [16,17]. For example, the ABA8Ox (CYP707A) gene is upregulated under drought stress in maize [18]. The CYP707A1 and CYP707A2 genes are highly expressed under osmotic stress and drought stress in Arabidopsis and Arachis hypogaea, respectively [19]. CYP96A8 is involved in lignin biosynthesis and drought stress responses [14,18]. In Arabidopsis, the CYP86A2 mutant reduces cuticle membrane thickness and enhances water permeability in response to drought stress [20]. In sorghum, CYP71A25 and CYP71B2 are upregulated under drought stress [14,15,16]. The CYP genes play a significant role in maintaining ROS hemostasis to enhance abiotic stress tolerance. TaCYP81D5 and two Arabidopsis genes (AtCYP709B3 and AtCYP81D8) enhance salinity stress tolerance by facilitating the ROS scavenging activities in wheat and Arabidopsis, respectively [14,15,17,21]. The CYP88A gene exhibits an enhanced expression level under Al toxicity in wheat [14,22]. The CYP81D8 gene, putatively involved in metabolism, shows a four-fold increase in the expression in Arabidopsis under AL stress.
In this study, we identified a CYP gene, BrCYP71A15, in Chinese cabbage, which is involved in Hg stress tolerance. In Chinese cabbage treated with Hg stress, the expression level of the BrCYP71A15 gene was enhanced. The BrCYP71A15 gene was cloned to yeast using the pRS416 vector to investigate its functions in response to Hg stress, which exhibited high sensitivity to Hg stress. The pRS416-GFP vector was used to test the subcellular localization of the BrCYP71A15 gene under salinity stress in yeast. Our study will be helpful for the understanding of the function of the BrCYP71A15 gene and genetic modification of Chinese cabbage, which can improve crop production and adaptation to environmental cues. It will be more interesting to explore the role of the BrCYP71A15 gene in the hormone signaling pathway and ROS scavenging to identify novel mechanisms in Chinese cabbage. Future research on BrCYP71A15 will offer the possibility of genetically engineered crop varieties with enhanced crop production.
2. Results
2.1. The Effect of Hg Stress on the Chlorophyll Content
The chlorophyll content is extremely sensitive to environmental influences and degrades very quickly. In this study, Chinese cabbage seedlings were exposed to Hg for 7 days, and the chlorophyll content was determined. The results indicated that Hg stress had a detrimental effect on chlorophyll. The chlorophyll a content was reduced by 41.72% under Hg stress compared with that of CK. Similarly, chlorophyll b, carotenoid, chlorophyll A+B and chlorophyll A/B contents were reduced by 26.10%, 45.25%, 39.48% and 34.32%, respectively, compared with those of CK as presented in Figure 1. These findings indicate that Hg stress significantly reduced the chlorophyll content, thereby greatly hindering plant growth and production.
2.2. BrCYP71A15 Gene Induced by Hg Stress in Chinese Cabbage
To explore the transcript abundance of the BrCYP71A15 gene under Hg stress, Chinese cabbage seedlings were exposed to 100 μM Hg stress. The whole plant samples were collected at different times, i.e., 0, 2, 4, 8, 12, 24 and 36 h after Hg stress. The quantitative reverse transcription PCR (RT-qPCR) results showed that the mRNA abundance was the same at 0 h but three-fold higher than that of CK and then gradually decreased over time as presented in Figure 2. The transcript abundance between CK and samples under Hg stresses was significantly different. These results indicate that the BrCYP71A15 gene might play an important role in response to Hg stress.
2.3. Expression Patterns of the BrCYP71A15 Gene under Different Abiotic Stresses
The BrCYP71A15 gene plays an important role in regulating plant response to abiotic stresses. However, its function is yet to be fully understood. To confirm the molecular mechanism of the BrCYP71A15 gene under abiotic stresses, their expression level was investigated under Hg, Cd and NaCl stresses and compared with the CK (Control), as presented in Figure 3. The results indicate that the BrCYP71A15 gene was highly expressed under Hg stress, followed by NaCl stress. The expression level of BrCYP71A15 was reduced under Cd stress compared with that of CK and those under Hg and NaCl stresses (Figure 3). These findings suggested that the transcript level of BrCYP71A15 was significantly induced by stress and BrCYP71A15 might be involved in Hg stress tolerance in Chinese cabbage.
2.4. Expression Patterns of the BrCYP71A15 Gene in Different Tissues of Chinese Cabbage
To investigate the role of the BrCYP71A15 gene in plant growth and development, we explored its expression in different tissues of Chinese cabbage. The results suggested that the BrCYP71A15 gene was highly expressed in roots, followed by older leaves, as presented in Figure 4A. However, the expression level of the BrCYP71A15 gene was reduced in young leaves, midribs, leaf veins and stems, compared with that of roots and old leaves. The TPM (transcript per million) value was obtained from a Chinese cabbage database (
2.5. BrCYP71A15 Protein–Protein Association Network
The STRING database was used to investigate the protein–protein network of BrCYP71A15. The PPA network contained 10 proteins, 11 nodes and 16 edges, with a local clustering coefficient of 0.876 and a PPI enrichment p-value of 0.079 (Figure 5). Different values were assigned to each node. The edges were assigned with different scores, with darker edges representing higher scores, indicating it had stronger interactions with other proteins. The results showed that a number of proteins, including Bra036911 (Ferredoxin c 1), Bra004905 (uncharacterized protein), Bra018180 (Alpha-glucan phosphate 2), Bra013823 (uncharacterized protein), Bra015511 (4-hydroxyphenylpyruvate dioxygenase), Bra032415 (4-hydroxyphenylpyruvate dioxygenase), Bra038834 (uncharacterized protein), Bra038834 (uncharacterized protein), Bra023865 (uncharacterized protein) and Bra031299 (uncharacterized protein), exhibited higher degrees of connections. The connection between Bra036911 and BrCYP71A15 protein was significant, indicating they might directly interact with each other.
2.6. BrCYP71A15 Overexpression in Response to Abiotic Stresses in Yeast
To elucidate the function of the BrCYP71A15 gene in abiotic stress tolerance, we generated a BrCYP71A15 overexpressing yeast model using the pRS416-GFP vector. The BrCYP71A15 overexpressing cells were exposed to abiotic stresses (75 μM Cd, 100 mM Hg, 100 μM Al, 50 μM Cu and 1 M NaCl), as presented in Figure 6. The results show that the cells exhibited no response to Cd, Al, NaCl and Cu stresses. However, the expression of BrCYP71A15 was highly sensitive to Hg stress compared with EV (Figure 6b), and thus, BrCYP71A15 might play a significant role in response to Hg stress.
Furthermore, we conducted the growth curve of the yeast cells overexpressing BrCYP71A15 without and with Hg stress, as presented in Figure 7. Compared with EV, the transgenic cells show more sensitivity than those EV-expressing cells. Under Hg stress, there was no significant difference between EV and BrCYP71A15-overexpressing cells at 6 h. Then, the growth of the EV-expressing cells gradually became faster, and a significant difference was observed compared with that of the BrCYP71A15-overexpressing cells. These results indicate BrCYP71A15 played a key role in Hg stress tolerance.
2.7. Subcellular Localization of the BrCYP71A15 Gene
There is no evidence supporting the translocation of the BrCYP71A15 gene into the nucleus under Hg stress. To confirm the subcellular localization, the BrCYP71A15 gene was transiently expressed in fusion of GFP in yeast and the fluorescence was observed through a confocal microscopy. Under control conditions, the BrCYP71A15 gene existed in the nucleus as dot-like structures, as presented in Figure 8. When treated with Hg stress, the BrCYP71A15 protein was translocated into the nucleus. These findings suggested that the BrCYP71A15 gene could specifically enter the nucleus under Hg stress.
2.8. Cell Wall Biosynthesis Gene
The cell wall is considered as a key barrier for heavy metals, triggering rescue mechanisms to maintain cellular integrity, and yeast is a convenient system to study the function of the cell wall against heavy metal [23,24] . In this study, we investigate the expression levels of genes that are involved in cell wall biosynthesis, remodeling, metabolism and signal transduction under different abiotic stresses. The results suggested that SPD1, BCK1, CCW14, CHA1, CWP1, GFA1, MKK1p, MKK2p, RIM1p and SED1 genes were expressed in BrCYP71A15-overexpressing yeast cells under Hg stress compare with the control (Figure 9). However, PST1, PIR3 and PTC1 genes were significantly downregulated in BrCYP71A15-overexpressing yeast cells under Hg stress. The expression of HSP12 and CRH1 genes showed no difference between the EV and BrCYP71A15-overexpressing cells, as presented in Figure 9. Cell wall biosynthesis-related genes showed a dynamic response to Hg stress, which might be involved in BrCYP71A15 gene activation under Hg stress.
3. Discussion
Plants under heavy metal stresses can enhance ROS production, which is highly toxic in nature and causes detrimental effects on chlorophyll, protein, hormonal biosynthesis and enzyme activities [25,26]. Plants have evolved a series of pathways to cope with ROS production to minimize the harmful effects of heavy metal stress, including antioxidant enzymes, hormones, transcription factors and stress responsive genes [12]. Among various heavy metals, mercury (Hg) is considered the most toxic heavy metal, exhibiting strong harmful effects on plant growth and development [5]. Hg stress disrupts many molecular, biochemical, physiological, cellular mechanisms, thereby greatly reducing plant growth and productivity [6]. In the present study, we reported that Hg stress resulted in a significant reduction in the chlorophyll content of plants (Figure 1). A previous study reported that Hg stress increases ROS accumulation and reduces the chlorophyll content [27], which is consistent with our findings. Plants exposed to heavy metal stresses show increased heavy metal accumulation, which leads to the overproduction of ROS such as H2O2 and O2 [13,25]. Numerous studies have reported that heavy metal stresses can cause deleterious effects on plant growth and decreased chlorophyll contents due to the overproduction of ROS [5,6]. These findings suggested that Hg stress might increase the overproduction of ROS and lead to a significant reduction in chlorophyll accumulations in Chinese cabbage.
The BrCYP71A15 gene has high similarity with the Arabidopsis gene CYP71A15 (AT5G24950). BrCYP71A15 is a constituent family member of putative cytochrome P450, which controls plant growth, seed development, germination and other physiochemical and biochemical characteristics [15]. The putative cytochrome P450 is ubiquitously founded in plant species [14]. Recent studies show that CYP714 family genes are involved in gibberellin deactivation and homeostasis through 16a, 17-epoxidation or 13-hydroxylation in rice and Arabidopsis [14]. The protein–protein association network suggests that the dynamic interaction and correlation of BrCYP71A15 with other proteins (Figure 5) might be involved in regulation and activation under stress conditions. However, the functions of the BrCYP71A15 gene have not been directly reported. Here, we provide evidence which shows that BrCYP71A15 might regulate Hg stress tolerance in yeast.
A number of genes are involved in hormonal control of plant growth, development and biotic and abiotic stress responses. This work demonstrates that BrCYP71A15 is potentially involved in Hg stress response. As presented in Figure 4, BrCYP71A15 genes show different transcription levels (TPM) in various tissues and are highly expressed in root tissues. The expression pattern of genes is a significant indication for biological functions and molecular mechanisms [7]. Plants uptake and translocate Hg from soil through roots to different tissues, and we report that BrCYP71A15 was mostly expressed in roots, which might be the reason that the plant had high sensitivity to Hg stress (Figure 6). Root is the key organ that has early contacts with Hg and is also responsible for the absorption and translocation of Hg, and thus, it might be the reason that BrCYP71A15 has high expression in roots (Figure 1). A previous study reported Cyp96b4/dss1 mutants regulate ABA biosynthesis and accumulation to enhance drought stress tolerance in rice [17]. Similarly, the CYP709B3 gene plays a key role in the regulation of salinity stress tolerance and enhances the expression level in Arabidopsis [16]. Based on these results, it can be concluded that the expression level of BrCYP71A15 was increased (Figure 2 and Figure 3) and hence the plant exhibited enhanced sensitivity to Hg stress (Figure 6).
miRNAs are a class of noncoding RNA molecules with a length of 20–24 bp, which play a key role in plant growth and abiotic stress tolerance [25]. These miRNAs are considered as a central regulator of transcription activation under stress conditions [5]. We reported 10 miRNAs targeting the BrCYP71A15 gene, which might be involved in various developmental processes including abiotic stress responses (Table 1). In Brassica, miR160 shows a significant response to Cd stress, and its transcript level is elevated, while miR164b and miR394s are upregulated under sulfate deficiency [5,28,29]. Cd stress increases the expression of MiR156, MiR171, MiR393 and MiR396a in roots of B. naps [5]. Likewise, Medicage truncatula has been treated with Hg, Al and Cd to investigate the expression level of miRNAs. miR171, miR319, miR393 and miR529 are activated when exposed to heavy metal stresses (Hg, Al and Cd) [5,30]. These findings suggest that miRNAs are potentially involved in heavy metal stress tolerance. In this study, we reported that BrCYP71A15 regulated the expression of miRNAs that might be involved in Hg stress tolerance response (Table 1).
The BrCYP71A15-overexpressing cells showed high sensitivity to Hg stress (Figure 6a,b), and the accumulation of the Hg content was elevated (Figure 7). A previous study reported that the cell wall plays a significant role in the protection of cells from abiotic stresses [31]. The cell wall provides a strong barrier to environmental influences and reduces harmful effects [31,32,33]. In yeast, the transcriptional reprogramming can activate the transcript level of genes involved in cell wall biosynthesis, signal transduction and stress responses [31,33]. Studies have reported that SLT2, MAPK and MAPKK1 are involved in cell wall biosynthesis [31,34]. In this study, Hg stress activated the transcript levels of cell wall biosynthesis gene in BrCYP71A15 (Figure 9). The expression of SPD1, BCK1, CCW14, CHA1, CWP1, GFA1, MKK1p, MKK2p, RIM1p and SED1 genes was elevated when exposed to Hg stress, but the expression of PST1, PIR3 and PTC1 was downregulated. These results indicate that BrCYP71A15 interacts with cell wall biosynthesis genes when exposed to Hg stress. Protein Kinase C (PKC1) is regulated by BCK1p, MKK1p, SLT2p and ROM2p, which plays a fundamental role in cell wall biosynthesis, maintenance and cell integrity [23,31]. These findings are supported by a previous study, which reported that S1Fa OE cells regulate cell wall biosynthesis genes under salt stress in yeast [4]. Hence, it can be concluded that the BrCYP71A15 gene interacts with cell wall biosynthesis genes, and thus, Hg sensitivity is enhanced, and the accumulation of the Hg content is increased in yeast cells. Interestingly, under Hg stress, BrCYP71A15 was located in the nucleus (Figure 8), which might promote the transcription of cell wall biosynthesis genes. Taken together, the BrCYP71A15 gene was highly expressed in roots and showed high sensitivity to Hg stress. Thus, the Hg content might be increased in yeast cells, and the expression of cell wall biosynthesis genes might be activated. These findings are in line with previous studies, which reported that salt stress reduces the antioxidant enzymatic activities, enhances the ROS and MDA contents in S1fa cells and regulates the transcript level of genes involved in cell wall integrity [4]. In summary, it can be concluded that the BrCYP71A15 gene exhibits high sensitivity to Hg stress and increases Hg accumulation, which may play a key role in cell wall biosynthesis under Hg stress. Further investigations are needed to identify downstream genes to fully understand the function of the BrCYP71A15 gene in response to Hg stress.
4. Materials and Methods
Chinese cabbage (Cv. Guangdongzao) seeds were presoaked with 1% sodium hypochlorite for 3 min and then washed at least five times with ddH2O to remove excessive sodium hypochlorite from the seed surface. The seeds were germinated in ½MS media in a controlled growth chamber, transferred to a hydroponic culture and incubated for five more days before being treated with 50 μM Cd, 100 mM Hg and 1 M NaCl, respectively. The samples were collected after two days after treatments and ground in liquid nitrogen to extract the total RNA [4].
4.1. Chlorophyll Contents
The total chlorophyll contents were determined by extraction in 95% ethanol and measured using a spectrophotometer. As described previously, the absorbance levels were measured at 470, 649 and 666 nm [35].
4.2. Yeast Constructs
The yeast (Saccharomyces cerevisiae) cells (GRY472 cells) were used in this study (
To predict the miRNAs, the coding sequence of the BrCYP71A15 gene was submitted to the psRNATarget server (
4.3. Hg Concentration in Yeast Cells
Yeast strains grown on SC solid plates with 100 µM HgCl2 at 30 °C for 2 d. Cells were collected in liquid SC, and the OD600 was recorded before atomic absorption spectrometer measuring. Hg2+ content was measured with the 7700X ICP-MS (Agilent) [36].
4.4. Tolerance Assay and Growth Curve
The final pRS416-GFP vector-overexpressing yeast cells cultured in the URA medium were diluted until the OD600 value was 0.1 and then were incubated again until the OD600 reached 0.3. The cell culture was then diluted four-fold and treated with 75 μM Cd, 100 mM Hg, 100 μM Al, 50 μM Cu, 1 M NaCl and URA (control), respectively, and incubated at 30 °C for five days [9]. No treatment was added for the control. The photos were taken after five days of incubation, and the experiment was repeated three times. The BrCYP71A15 overexpressing yeast cells without and with the Hg treatment were grown at 30 °C in a liquid URA culture medium and diluted until the OD600 value was about 0.1. The cells were incubated again until the OD600 value reached 0.3, and then the OD600 was recorded every 2 h to prepare the growth curve of the cells [9].
4.5. Total RNA Extraction and qRT-PCR Analysis
The total RNA was extracted for Chinese cabbage tissues using TRIzol, while yeast RNA was extracted using the M5 EASYspin yeast RNA rapid extraction kit, MF158-01 (Mei5 Biotechnology, Co., Ltd.). For yeast RNA extraction, the cells were grown until the OD600 value reached 0.3 at 28 °C and then treated with Hg for 18 h before the total RNA was harvested [4]. The first-stand cDNA was synthesized using a PrimeScript and RT reagent kit with gDNA Eraser (TAKARA). The SYBR Premix Ex-Taq Kit (TAKARA) was used for quantitative real-time PCR. All experiments were performed with three independent biological replications. The transcript levels were calculated using the 2ΔΔ-CT method. The TMP values of Chinese cabbage tissues were obtained from the Chinese cabbage database (
4.6. Statistical Analysis
Three independent biological replications were used for each treatment, and the whole experiment was repeated three times. The data were statistically analyzed using an analysis of variance and compared with the control using the LSD test (p > 0.05) by using the Statistix 8.1 software (
5. Summary
In this study, we identified BrCYP71A15, which participates in the immediate response to Hg stress in yeast cells. The BrCYP71A15 gene is expressed in different tissues of Chinese cabbage, while mostly expressed in root tissues. The expression level of the BrCYP71A15 gene increased over time when exposed to Hg stress. Compared with other abiotic stresses, the expression level of the BrCYP71A15 gene was the highest under Hg stress. The overexpression of BrCYP71A15 showed high sensitivity to Hg stress, and the accumulation of Hg was increased in yeast cells, which, in turn, regulated the expression of cell wall biosynthesis genes. Thus, it can be concluded that the BrCYP71A15 gene is potentially involved in Hg stress response. Further comprehensive studies are required to explore the physiological and molecular mechanisms of BrCYP71A15 in Hg stress tolerance, which will improve protected vegetable crop production as well as provide a strong background for genetic crop implements.
Conceptualization, A.A., S.Z. and L.H.; methodology, A.A. and S.Z.; software, A.A., S.Z. and L.W.; validation, A.A. and L.H.; formal analysis, A.A. and L.H.; investigation, A.A.; resources, J.G., S.Z. and L.H.; data curation, A.A. and S.Z.; writing—original draft preparation, A.A.; writing—review and editing, L.H., L.W. and S.Z.; visualization, S.Z.; supervision, J.G.; project administration, J.G.; funding acquisition, J.G., L.W. and L.H. All authors have read and agreed to the published version of the manuscript.
Not applicable.
The authors declare no conflict of interest.
Footnotes
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.
Figure 1. The effects of Hg stress on the chlorophyll content in Chinese cabbage seedlings. Different letters above the bar indicate significant difference at p < 0.05.
Figure 2. BrCYP71A15 transcription abundance under Hg stresses in Chinese cabbage. The transcript abundance was determined by qRT-PCR in Chinese cabbage seedlings treated with 100 mM Hg. Error bars indicate ± standard deviation.
Figure 3. The expression level of the BrCYP71A15 gene under NaCl, Cd and Hg stresses. Colors indicate different stresses, and letters above the error bar represent significant differences at p > 0.005.
Figure 4. The expression of BrCYP71A15 in different tissues of Chinese cabbage (A), and TPM data (B) were download from Chinese cabbage database (http://brassicadb.cn/#/, accessed on 18 August 2022).
Figure 6. (a) The BrCYP71A15 response to heavy metal stress tolerance in yeast. Empty vector (yeast wild-type) and BrCYP71A15 OE cells were grown in URA liquid medium for 24 h at 30 °C. OD600 was adjusted to 0.3, and the cells were subjected to different types of abiotic stresses, including URA (Control) (A), Hg (B), Cd (C), Al (D), Cu (E) and NaCl (F). The upper mentioned folds represent the serial 10-fold dilution (the starting concentration (OD600) is 0.3. All experiments are repeated three times. (b) The growth curves of BrCYP71A15-overexpressing cells under 100 mM Hg stress. Yeast cells with EV (empty vector (Yeast WT)) and expressing BrCYP71A15 were grown at 30 °C. Cell density was monitored at 0, 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22 and 24 h after the treatment. Error bar represents the deviation of three independent replications.
Figure 7. Hg concentration in yeast cells. Yeast strains expressing EV and BrCYP71A15 were grown at 30 °C for 2 d. The cells were collected in liquid SC with 100 mM Hg and the OD600 values were measured using an atomic absorption spectrometer. Error bars indicate ± SD of three independent experiments. Letters above the error bar represent significant differences at p > 0.005.
Figure 8. The subcellular localization of BrCYP71A15 and empty vector tagged with GFP and transiently expressed in yeast cells treated with 100 mM Hg. The images were obtained from GFP, merged and bright channels. Scale bar: 10 μm.
Figure 9. qRT-PCR analysis was used to assess the expression level of cell wall biosynthesis genes under Hg stress in yeast. Error bar represents the deviation of three independent replications, and letters above error bar represents significant differences at p > 0.005.
Prediction of miRNAs targeting the BrCYP71A15 gene of Chinese cabbage.
miRNA | Gene | Length | Start | End | miRNA Aligned Fragment | Alignment | Targeted Fragment | Inhibition |
---|---|---|---|---|---|---|---|---|
ath-miR5644 | Bra033509 | 20 | 81 | 100 | GUGGGUUGCGGAUAACGGUA | ::: :: :::.::::.:: | CACCUCUAACCGUAACCUAC | Cleavage |
ath-miR8183 | Bra033509 | 21 | 232 | 252 | UUUAGUUGACGGAAUUGUGGC | ....:.::.:::::.::.: | CUUGUAGUUUCGUCAGCUGAC | Cleavage |
ath-miR854a | Bra033509 | 21 | 217 | 237 | GAUGAGGAUAGGGAGGAGGAG | .: : ::::::::::..: | GGUCGCGUCCCUAUCCUUGUA | Cleavage |
ath-miR854b | Bra033509 | 21 | 217 | 237 | GAUGAGGAUAGGGAGGAGGAG | .: : ::::::::::..: | GGUCGCGUCCCUAUCCUUGUA | Cleavage |
ath-miR854c | Bra033509 | 21 | 217 | 237 | GAUGAGGAUAGGGAGGAGGAG | .: : ::::::::::..: | GGUCGCGUCCCUAUCCUUGUA | Cleavage |
ath-miR854d | Bra033509 | 21 | 217 | 237 | GAUGAGGAUAGGGAGGAGGAG | .: : ::::::::::..: | GGUCGCGUCCCUAUCCUUGUA | Cleavage |
ath-miR854e | Bra033509 | 21 | 217 | 237 | GAUGAGGAUAGGGAGGAGGAG | .: : ::::::::::..: | GGUCGCGUCCCUAUCCUUGUA | Cleavage |
ath-miR2934-5p | Bra033509 | 21 | 733 | 753 | UCUUUCUGCAAACGCCUUGGA | :..: :: :::: .::::.:: | UUUAUGGAGUUUCUAGAAGGA | Cleavage |
ath-miR426 | Bra033509 | 21 | 1268 | 1288 | UUUUGGAAAUUUGUCCUUACG | : :::::::. ::.:::. | UUUCAGGACAAGAUUUCAAGU | Cleavage |
ath-miR5632-3p | Bra033509 | 21 | 808 | 828 | UUGGAUUUAUAGUUGGAUAAG | ::: : ..:: ::::.::: | GAUAUGCUGUUACAAAUUCAA | Cleavage |
Supplementary Materials
The following supporting information can be downloaded at:
References
1. Gu, M.; Li, N.; Ty, S.; Xh, L.; Brestic, M.; Shao, H.; Li, J.; Rki, S. Accumulation capacity of ions in cabbage (Brassica oleracea L.) supplied with sea water. Plant Soil Environ.; 2016; 62, pp. 314-320. [DOI: https://dx.doi.org/10.17221/771/2015-PSE]
2. Park, S.; Valan Arasu, M.; Lee, M.K.; Chun, J.H.; Seo, J.M.; Lee, S.W.; Al-Dhabi, N.A.; Kim, S.J. Quantification of glucosinolates, anthocyanins, free amino acids, and vitamin C in inbred lines of cabbage (Brassica oleracea L.). Food Chem.; 2014; 145, pp. 77-85. [DOI: https://dx.doi.org/10.1016/j.foodchem.2013.08.010] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/24128451]
3. Yang, L.; Wu, Y.; Wang, X.; Lv, J.; Tang, Z.; Hu, L.; Luo, S.; Wang, R.; Ali, B.; Yu, J. Physiological Mechanism of Exogenous 5-Aminolevulinic Acid Improved the Tolerance of Chinese Cabbage (Brassica pekinensis L.) to Cadmium Stress. Front. Plant Sci.; 2022; 13, 845396. [DOI: https://dx.doi.org/10.3389/fpls.2022.845396]
4. Anwar, A.; Zhang, S.; Wang, L.X.; Wang, F.; He, L.; Gao, J. Genome-Wide Identification and Characterization of Chinese Cabbage S1fa Transcription Factors and Their Roles in Response to Salt Stress. Antioxidants; 2022; 11, 1782. [DOI: https://dx.doi.org/10.3390/antiox11091782] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/36139856]
5. Huang, S.Q.; Peng, J.; Qiu, C.X.; Yang, Z.M. Heavy metal-regulated new microRNAs from rice. J. Inorg. Biochem.; 2009; 103, pp. 282-287. [DOI: https://dx.doi.org/10.1016/j.jinorgbio.2008.10.019]
6. Ghori, N.H.; Ghori, T.; Hayat, M.Q.; Imadi, S.R.; Gul, A.; Altay, V.; Ozturk, M. Heavy metal stress and responses in plants. Int. J. Environ. Sci. Technol.; 2019; 16, pp. 1807-1828. [DOI: https://dx.doi.org/10.1007/s13762-019-02215-8]
7. Anwar, A.; Liu, Y.; Dong, R.; Bai, L.; Yu, X.; Li, Y. The physiological and molecular mechanism of brassinosteroid in response to stress: A review. Biol. Res.; 2018; 51, 46. [DOI: https://dx.doi.org/10.1186/s40659-018-0195-2]
8. He, Y.; Chen, Y.; Song, W.; Zhu, L.; Dong, Z.; Ow, D.W. A Pap1–Oxs1 signaling pathway for disulfide stress in Schizosaccharomyces pombe. Nucleic Acids Res.; 2017; 45, pp. 106-114. [DOI: https://dx.doi.org/10.1093/nar/gkw818]
9. Jing, Y.; Shi, L.; Li, X.; Zheng, H.; Gao, J.; Wang, M.; He, L.; Zhang, W. OXS2 is Required for Salt Tolerance Mainly through Associating with Salt Inducible Genes, CA1 and Araport11, in Arabidopsis. Sci. Rep.; 2019; 9, 20341. [DOI: https://dx.doi.org/10.1038/s41598-019-56456-1]
10. He, L.; Jing, Y.; Shen, J.; Li, X.; Liu, H.; Geng, Z.; Wang, M.; Li, Y.; Chen, D.; Gao, J. et al. Mitochondrial Pyruvate Carriers Prevent Cadmium Toxicity by Sustaining the TCA Cycle and Glutathione Synthesis. Plant Physiol.; 2019; 180, pp. 198-211. [DOI: https://dx.doi.org/10.1104/pp.18.01610]
11. Shao, R.; Zhang, J.; Shi, W.; Wang, Y.; Tang, Y.; Liu, Z.; Sun, W.; Wang, H.; Guo, J.; Meng, Y. et al. Mercury stress tolerance in wheat and maize is achieved by lignin accumulation controlled by nitric oxide. Environ. Pollut.; 2022; 307, 119488. [DOI: https://dx.doi.org/10.1016/j.envpol.2022.119488]
12. Gill, S.S.; Tuteja, N. Reactive oxygen species and antioxidant machinery in abiotic stress tolerance in crop plants. Plant Physiol. Biochem.; 2010; 48, pp. 909-930. [DOI: https://dx.doi.org/10.1016/j.plaphy.2010.08.016]
13. Nath, M.; Bhatt, D.; Jain, A.; Saxena, S.C.; Saifi, S.K.; Yadav, S.; Negi, M.; Prasad, R.; Tuteja, N. Salt stress triggers augmented levels of Na+, Ca2+ and ROS and alter stress-responsive gene expression in roots of CBL9 and CIPK23 knockout mutants of Arabidopsis thaliana. Environ. Exp. Bot.; 2019; 161, pp. 265-276. [DOI: https://dx.doi.org/10.1016/j.envexpbot.2018.10.005]
14. Pandian, B.A.; Sathishraj, R.; Djanaguiraman, M.; Prasad, P.V.V.; Jugulam, M. Role of Cytochrome P450 Enzymes in Plant Stress Response. Antioxidants; 2020; 9, 454. [DOI: https://dx.doi.org/10.3390/antiox9050454]
15. Liu, Z.; Boachon, B.; Lugan, R.; Tavares, R.; Erhardt, M.; Mutterer, J.; Demais, V.; Pateyron, S.; Brunaud, V.; Ohnishi, T. et al. A Conserved Cytochrome P450 Evolved in Seed Plants Regulates Flower Maturation. Mol. Plant; 2015; 8, pp. 1751-1765. [DOI: https://dx.doi.org/10.1016/j.molp.2015.09.002]
16. Mao, G.; Seebeck, T.; Schrenker, D.; Yu, O. CYP709B3, a cytochrome P450 monooxygenase gene involved in salt tolerance in Arabidopsis thaliana. BMC Plant Biol.; 2013; 13, 169. [DOI: https://dx.doi.org/10.1186/1471-2229-13-169]
17. Tamiru, M.; Undan, J.R.; Takagi, H.; Abe, A.; Yoshida, K.; Undan, J.Q.; Natsume, S.; Uemura, A.; Saitoh, H.; Matsumura, H. et al. A cytochrome P450, OsDSS1, is involved in growth and drought stress responses in rice (Oryza sativa L.). Plant Mol. Biol.; 2015; 88, pp. 85-99. [DOI: https://dx.doi.org/10.1007/s11103-015-0310-5]
18. Kushiro, T.; Okamoto, M.; Nakabayashi, K.; Yamagishi, K.; Kitamura, S.; Asami, T.; Hirai, N.; Koshiba, T.; Kamiya, Y.; Nambara, E. The Arabidopsis cytochrome P450 CYP707A encodes ABA 8′-hydroxylases: Key enzymes in ABA catabolism. Embo J.; 2004; 23, pp. 1647-1656. [DOI: https://dx.doi.org/10.1038/sj.emboj.7600121]
19. Okamoto, M.; Kuwahara, A.; Seo, M.; Kushiro, T.; Asami, T.; Hirai, N.; Kamiya, Y.; Koshiba, T.; Nambara, E. CYP707A1 and CYP707A2, which encode abscisic acid 8′-hydroxylases, are indispensable for proper control of seed dormancy and germination in Arabidopsis. Plant Physiol.; 2006; 141, pp. 97-107. [DOI: https://dx.doi.org/10.1104/pp.106.079475]
20. Xiao, F.; Goodwin, S.M.; Xiao, Y.; Sun, Z.; Baker, D.; Tang, X.; Jenks, M.A.; Zhou, J.M. Arabidopsis CYP86A2 represses Pseudomonas syringae type III genes and is required for cuticle development. Embo J.; 2004; 23, pp. 2903-2913. [DOI: https://dx.doi.org/10.1038/sj.emboj.7600290]
21. Wang, M.; Yuan, J.; Qin, L.; Shi, W.; Xia, G.; Liu, S. TaCYP81D5, one member in a wheat cytochrome P450 gene cluster, confers salinity tolerance via reactive oxygen species scavenging. Plant Biotechnol. J.; 2020; 18, pp. 791-804. [DOI: https://dx.doi.org/10.1111/pbi.13247] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/31472082]
22. Helliwell, C.A.; Chandler, P.M.; Poole, A.; Dennis, E.S.; Peacock, W.J. The CYP88A cytochrome P450, ent-kaurenoic acid oxidase, catalyzes three steps of the gibberellin biosynthesis pathway. Proc. Natl. Acad. Sci. USA; 2001; 98, pp. 2065-2070. [DOI: https://dx.doi.org/10.1073/pnas.98.4.2065] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/11172076]
23. Techo, T.; Charoenpuntaweesin, S.; Auesukaree, C. Involvement of the Cell Wall Integrity Pathway of Saccharomyces cerevisiae in Protection against Cadmium and Arsenate Stresses. Appl. Environ. Microbiol.; 2020; 86, e01339-20. [DOI: https://dx.doi.org/10.1128/AEM.01339-20] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/32859590]
24. Grosjean, N.; Le Jean, M.; Chalot, M.; Mora-Montes, H.M.; Armengaud, J.; Gross, E.M. Genome-Wide Mutant Screening in Yeast Reveals that the Cell Wall is a First Shield to Discriminate Light From Heavy Lanthanides. Front. Microbiol.; 2022; 13, 881535. [DOI: https://dx.doi.org/10.3389/fmicb.2022.881535] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/35663896]
25. Anwar, A.; Kim, J.K. Transgenic Breeding Approaches for Improving Abiotic Stress Tolerance: Recent Progress and Future Perspectives. Int. J. Mol. Sci.; 2020; 21, 2965. [DOI: https://dx.doi.org/10.3390/ijms21082695]
26. van Zelm, E.; Zhang, Y.; Testerink, C. Salt Tolerance Mechanisms of Plants. Annu. Rev. Plant Biol.; 2020; 71, pp. 403-433. [DOI: https://dx.doi.org/10.1146/annurev-arplant-050718-100005]
27. Malik, B.; Pirzadah, T.B.; Tahir, I.; Ul Rehman, R. Growth and physiological responses in chicory towards mercury induced in vitro oxidative stress. Plant Physiol. Rep.; 2019; 24, pp. 236-248. [DOI: https://dx.doi.org/10.1007/s40502-019-00442-2]
28. Bustos-Sanmamed, P.; Mao, G.; Deng, Y.; Elouet, M.; Khan, G.A.; Bazin, J.R.M.; Turner, M.; Subramanian, S.; Yu, O.; Crespi, M. et al. Overexpression of miR160 affects root growth and nitrogen-fixing nodule number in Medicago truncatula. Funct. Plant Biol.; 2013; 40, pp. 1208-1220. [DOI: https://dx.doi.org/10.1071/FP13123]
29. Singh, S.; Singh, A. A prescient evolutionary model for genesis, duplication and differentiation of MIR160 homologs in Brassicaceae. Mol. Genet. Genom.; 2021; 296, pp. 985-1003. [DOI: https://dx.doi.org/10.1007/s00438-021-01797-8]
30. Yang, T.; Wang, Y.; Teotia, S.; Wang, Z.; Shi, C.; Sun, H.; Gu, Y.; Zhang, Z.; Tang, G. The interaction between miR160 and miR165/166 in the control of leaf development and drought tolerance in Arabidopsis. Sci. Rep.; 2019; 9, 2832. [DOI: https://dx.doi.org/10.1038/s41598-019-39397-7]
31. Sanz, A.B.; García, R.; Rodríguez-Peña, J.M.; Arroyo, J. The CWI Pathway: Regulation of the Transcriptional Adaptive Response to Cell Wall Stress in Yeast. J. Fungi; 2017; 4, 1. [DOI: https://dx.doi.org/10.3390/jof4010001]
32. Zagorchev, L.; Kamenova, P.; Odjakova, M. The Role of Plant Cell Wall Proteins in Response to Salt Stress. Sci. World J.; 2014; 2014, 764089. [DOI: https://dx.doi.org/10.1155/2014/764089]
33. Gerik, K.J.; Donlin, M.J.; Soto, C.E.; Banks, A.M.; Banks, I.R.; Maligie, M.A.; Selitrennikoff, C.P.; Lodge, J.K. Cell wall integrity is dependent on the PKC1 signal transduction pathway in Cryptococcus neoformans. Mol. Microbiol.; 2005; 58, pp. 393-408. [DOI: https://dx.doi.org/10.1111/j.1365-2958.2005.04843.x]
34. Ying, S.; Zhang, D.F.; Fu, J.; Shi, Y.S.; Song, Y.C.; Wang, T.Y.; Li, Y. Cloning and characterization of a maize bZIP transcription factor, ZmbZIP72, confers drought and salt tolerance in transgenic Arabidopsis. Planta; 2012; 235, pp. 253-266. [DOI: https://dx.doi.org/10.1007/s00425-011-1496-7]
35. Anwar, A.; Di, Q.; Yan, Y.; He, C.; Li, Y.; Yu, X. Exogenous 24-epibrassinolide alleviates the detrimental effects of suboptimal root zone temperature in cucumber seedlings. Arch. Agron. Soil Sci.; 2019; 65, pp. 1927-1940. [DOI: https://dx.doi.org/10.1080/03650340.2019.1582768]
36. Song, W.Y.; Sohn, E.J.; Martinoia, E.; Lee, Y.J.; Yang, Y.Y.; Jasinski, M.; Forestier, C.; Hwang, I.; Lee, Y. Engineering tolerance and accumulation of lead and cadmium in transgenic plants. Nat. Biotechnol.; 2003; 21, pp. 914-919. [DOI: https://dx.doi.org/10.1038/nbt850]
You have requested "on-the-fly" machine translation of selected content from our databases. This functionality is provided solely for your convenience and is in no way intended to replace human translation. Show full disclaimer
Neither ProQuest nor its licensors make any representations or warranties with respect to the translations. The translations are automatically generated "AS IS" and "AS AVAILABLE" and are not retained in our systems. PROQUEST AND ITS LICENSORS SPECIFICALLY DISCLAIM ANY AND ALL EXPRESS OR IMPLIED WARRANTIES, INCLUDING WITHOUT LIMITATION, ANY WARRANTIES FOR AVAILABILITY, ACCURACY, TIMELINESS, COMPLETENESS, NON-INFRINGMENT, MERCHANTABILITY OR FITNESS FOR A PARTICULAR PURPOSE. Your use of the translations is subject to all use restrictions contained in your Electronic Products License Agreement and by using the translation functionality you agree to forgo any and all claims against ProQuest or its licensors for your use of the translation functionality and any output derived there from. Hide full disclaimer
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/). Notwithstanding the ProQuest Terms and Conditions, you may use this content in accordance with the terms of the License.
Abstract
Over the past two decades, heavy metal pollution has been a common problem worldwide, greatly threatening crop production. As one of the metal pollutants, Mercury (Hg) causes damage to plant cells and reduces cellular and biochemical activities. In this study, we identified a novel cytochrome P450 family gene, BrCYP71A15, which was involved in Hg stress response in yeast. In Chinese cabbage, the BrCYP71A15 gene was located on chromosome A01, which was highly expressed in roots. Additionally, the expression level of BrCYP71A15 was induced by different heavy metal stresses, and the BrCYP71A15 protein exhibited a strong interaction with other proteins. Overexpression of BrCYP71A15 in yeast cells showed no response to a number of heavy metal stresses (Cu, Al, Co, Cd) in yeast but showed high sensitivity to Hg stress; the cells grew slower than those carrying the empty vector (EV). Moreover, upon Hg stress, the growth of the BrCYP71A15-overexpressing cells increased over time, and Hg accumulation in yeast cells was enhanced by two-fold compared with the control. Additionally, BrCYP71A15 was translocated into the nucleus under Hg stress. The expression level of cell wall biosynthesis genes was significantly influenced by Hg stress in the BrCYP71A15-overexpressing cells. These findings suggested that BrCYP71A15 might participate in HG stress tolerance. Our results provide a fundamental basis for further genome editing research and a novel approach to decrease Hg accumulation in vegetable crops and reduce environmental risks to human health through the food chain.
You have requested "on-the-fly" machine translation of selected content from our databases. This functionality is provided solely for your convenience and is in no way intended to replace human translation. Show full disclaimer
Neither ProQuest nor its licensors make any representations or warranties with respect to the translations. The translations are automatically generated "AS IS" and "AS AVAILABLE" and are not retained in our systems. PROQUEST AND ITS LICENSORS SPECIFICALLY DISCLAIM ANY AND ALL EXPRESS OR IMPLIED WARRANTIES, INCLUDING WITHOUT LIMITATION, ANY WARRANTIES FOR AVAILABILITY, ACCURACY, TIMELINESS, COMPLETENESS, NON-INFRINGMENT, MERCHANTABILITY OR FITNESS FOR A PARTICULAR PURPOSE. Your use of the translations is subject to all use restrictions contained in your Electronic Products License Agreement and by using the translation functionality you agree to forgo any and all claims against ProQuest or its licensors for your use of the translation functionality and any output derived there from. Hide full disclaimer