1. Introduction
As one of the most important and common Gram-negative bacteria (GNB) living in the gut of humans and animals, Escherichia coli (E. coli) can lead to severe diarrhea. E. coli can be transmitted between humans and animals, especially between pets and their owners [1,2,3,4]. With the occurrence of extended-spectrum β-Lactamases (ESBLs), bacterial resistance to β-lactams, especially cephalosporin, is becoming increasingly serious [5]. Research to explore antibiotic resistance mechanisms and methods to eliminate bacterial antimicrobial resistance has thus become high priority worldwide [6].
Several systematic reviews have described the complex mechanisms leading to antibiotic resistance, which can be mediated by plasmids, changes in target sites, modifications of antibiotic-degrading enzymes, cell adaptation, and efflux pumps, all of which have been linked to the inappropriate use of antibiotics [7,8]. Thus, the identification of antibiotic alternatives or synergistic approaches to reduce resistance is of great significance. There are studies which indicate that combinations of Chinese herb extracts and antibiotics show synergistic effects against E. coli via different mechanisms. A range of volatile oils from Cukangchai (Mallotus philippensis [Lam.] Muell. Arg.) inhibit the conjugal transfer of drug-resistant plasmids, which reduces the lateral transmission of drug-resistance [9]. Quercetin could cause MDR E. coli to regain susceptibility to tetracycline by increasing cell permeability and the intracellular drug concentration [10]. There are also studies that show that baicalin from Huangqin (Scutellaria baicalensis Georgi) inhibits the activity of NDM-1 and decreases the expression of fimB, which is a major bacterial adhesion factor [11,12]. Resveratrol from Lilu (Veratrum nigrum L.) reduces the expression of the efflux pump protein AcrAB-TolC in E. coli to inhibit drug resistance [13].
Garlic oil is an extractive from garlic (Allium sativum L.), which was recorded in the Ben Cao Gang Mu (Compendium of Materia Medica, edited by Li Shizhen between 1522–1578, Mind Dynasty) to invigorate the spleen and stop diarrhea, has the functions of detoxification, detumescence, removing wind, and breaking a cold according to the theory of Traditional Chinese Medicine. Garlic is also a plant used as homology in medicine and food by Chinese people. As shown in previous studies, garlic oil has multiple biological activities, including the prevention and amelioration of cancer [14], improvement of the cardiovascular system [15], and anti-inflammatory effects [16]. In addition, some previous studies showed that garlic and garlic extracts were able to decrease the resistance of some bacteria to antibiotics, such as methicillin-resistant staphylococcus aureus [17] and ampicillin-resistant E. coli [18]. Moreover, garlic oil has been shown to regulate composition of gut flora [19]. Based on that, in this study, garlic oil was hypothesized to be able to reduce E. coli ESBL-producers.
Our previous study on canine-origin feces E. coli, isolated from multiple cities in Shaanxi Province, showed that there was multidrug-resistance of E. coli to cefquinome, and the resistance was eliminated by magnolol [20]. To further understand the prevalence of pet-origin drug-resistant E. coli in different species of companion animals (such as cats) in a wider area, the sampling range in this study was expanded to seven cities in different regions of China, and feline feces were collected as the sampling source.
All in all, this study aimed to detect the prevalence of ESBL feline-origin E. coli in seven cities in China to explore the elimination effect and possible mechanism of garlic oil in the resistance of ESBL E. coli, focusing on the membrane structure.
2. Results
2.1. Samples and E. coli Isolates
A total of 80 E. coli strains were isolated from 101 feline fecal samples obtained using anal swabs, for a rate of 79.21% (Figure 1). As shown in Figure S1A 8 ESBL genes were detected. As shown in Figure 2C, 42 isolates (54.50%) were confirmed as ESBL E. coli.
In general, as shown in Figure 2A, the detection rate of TEM was the highest of tested genes at 100%, which is similar to our previous study [20]. The detection rate of CTX-M-1 group genes was 36.25%, which was the second highest. The third highest detection rate was CTX-M-9 group genes at 22.5%. The detection rates of CTX-M-2 group genes, OXA-1, and OXA-10 were similar at 2.5%, 2.5%, and 1.25%, respectively. CTX-M-8, CTX-M-25, SHV, and OXA-2 were not detected in this study.
The geographical ESBL gene detection rates in seven cities were similar, between 13% to 23%. The rate was 20.00% in Tangshan, 19.52% in Shenyang, 16.43% in Zhengzhou, 15.00% in Lanzhou, 16.00% in Guangzhou, 12.86% in Kunming, and 12.86% in Shanghai.
2.2. Antibiotic Susceptibility Testing and ESBL Confirmatory Test
The nine tested antibiotics were all β-lactams, including cephalosporin (cefoxitin, ceftriaxone, ceftazidime, cefotaxime, cefixime and cefquinome), penicillin (amoxicillin, ampicillin), and carbapenem (meropenem). As shown in Figure 2B and Figure S1B, the carbapenem class of antibiotics had the lowest resistance rate (17.50%). In contrast, the resistance rate of the detected penicillin class of antibiotics (93.75%) was highest. The resistance rate of cephalosporin was 71.25%. Furthermore, the resistance rates of detected 2nd, 3rd, and 4th generation cephalosporin antibiotics were 38.75% (cefoxitin), 76.25% (ceftriaxone, ceftazidime, cefotaxime, and cefixime), and 85% (cefquinome), respectively.
ESBL confirmatory tests (PCR method) were performed on isolates suspected to of ESBL E. coli. After PCR-positive products were sequenced and confirmed, as shown in Table 1, genes CTX-M-1, 15, 230, and 254 in CTX-M-1 family were detected; CTX-M-14, 27 and 104, in CTX-M-9 family were detected; and genes TEM-116 in TEM-1 family were detected. As shown in Figure 2C, the detection rate of ESBL E. coli was 52.50% (42/80). As shown in Figure 2D, two isolates (4.76%) carried three ESBL genes simultaneously. Ten isolates (23.81%) carrying two ESBL genes were detected. As shown in Figure 2E, the ESBL rate in Shenyang was the highest in this study at 76.19% (16/21). All of the rates from Zhengzhou, Tangshan, and Guangzhou were more than 50%, at 57.14% (8/14), 66.67% (6/9), and 60% (3/5), respectively. The detection rates of ESBL E. coli were relatively low in Lanzhou, Kunming, and Shanghai, at 40% (4/10), 28.57% (2/7), and 21.43% (3/14), respectively. To analyze the genetic relationship of ESBL isolates geographically, the phylogenetic tree is mapped. As shown in Table 1, the main epidemic types of ESBL E. coli in China were CTX-M-1, CTX-M-14, and TEM-116. As shown in Figure 3, ESBL E. coli isolates in this study do not appear to be geographically related.
2.3. Synergistic Effect of Garlic Oil in Combination with Cefquinome
To evaluate the potential synergistic effect of garlic oil combined with cefquinome, checkerboard dilution assays were performed against 16 ESBL E. coli strains detected in this study. The FICIs of the combination against isolates are shown in Table 2. Notably, the FICI of ATCC® 25922TM was <0.5, indicating that there was synergistic effect between garlic oil and cefquinome. The rate of synergistic effect was 68.75%. The rate of additive effect was 31.25%. Furthermore, the use of cefquinome in combined treatment decreased 16- to 32-fold compared to monotherapy, suggesting that garlic oil eliminates the resistance of ESBL E. coli to cefquinome in the study.
2.4. Garlic Oil Enhanced Effects of Cefquinome on Killing ESBL E. coli
Based on the results of MIC assays, time-kill curves were performed to evaluate the bactericidal effect of cefquinome against ESBL E. coli treated with garlic oil. As shown in Figure 4A, compared with either the single cefquinome group or the single garlic oil group, at all concentrations tested, the combination of garlic oil and cefquinome exhibited an enhanced bactericidal effect against the three tested ESBL E. coli strains within 24 h. From zero to eight hours, the population of E. coli strains in the low concentration combination group were 102- to 103-fold compared to CEF group. At the 24 h point, the differences in the population between the GAR + CEF group (the low concentration group) and the CEF group reached 105- to 106-fold. Moreover, the bactericidal effect appeared to be dose dependent, as demonstrated by the phenomenon that the group with a level of 0.5 MIC garlic oil combined with 0.25 MIC cefquinome killed almost all bacteria within six to eight hours, which indicated that garlic oil may be a potential antibiotic activator. The above results suggest that garlic oil exerts an effective and rapid bactericidal effect on ESBL E. coli.
2.5. Garlic Oil Enhances the Ability of Cefquinome to Inhibit Growth of ESBL E. coli
Based on the MICs of three ESBL isolates, the growth curves were performed to analyze the effects of the combination of garlic oil and cefquinome on inhibiting growth of ESBL E. coli. As shown in Figure 4B, compared with either the CEF group or the GAR group, the CEF + GAR group showed better effects on inhibiting the growth of ESBL E. coli within seven hours, similar to the negative control. The above results suggest that the combination of garlic oil and cefquinome may be an ideal bacterial-inhibiting combination.
2.6. Garlic Oil Restores the Sensitivity of ESBL E. coli to Cefquinome
Based on the results of MICs determined in generations 0, 1, 2, 3, 6, 9, and 15, drug-resistance curves were prepared to evaluate the changes in drug resistance of ESBL E. coli treated with garlic oil over the course of 15 generations. As shown in Figure 5, the MICs in the GAR group kept decreasing within 15 generations and the downtrend of MICs in negative control group was not stable. Compared with the negative control group, the MICs of ESBL E. coli strains in the GAR group decreased more quickly in the first three generations (8- to 64-fold compared to the negative group). After 15 generations, the MICs in the GAR group were 12 times lower than the negative group. In generations 1, 2, 3, 6, and 9 of TS7 and SH2, the MICs were significantly lower than the negative group. In generation 1, 2, 3, and 15 of ZZ4, the MICs were significantly lower than in the negative group, as the standard that: * p < 0.05 (difference), ** p < 0.01 (significant difference), *** p < 0.001 (significant difference), **** p < 0.0001 (significant difference). Moreover, after two-way ANOVA tests, besides significant influence caused by garlic oil treatment or different generations, there was an interaction between two factors that could lead to significant changes in MICs, which indicated that the resistance of ESBL E. coli to cefquinome may be reduced with long-term garlic oil treatment. These results collectively suggested that garlic oil could reduce the resistance of ESBL E. coli to cefquinome.
2.7. Effects of Garlic Oil Combined with Cefquinome on Membrane Destruction
PI staining and NPN staining were used to detect the cell membrane integrity and permeability. When cell inner membrane integrity was damaged, the nucleic acid in cells could be stained by PI, and then PI would release fluorescence. As shown in Figure 6A, the fluorescence intensity (FI) in combination groups was significantly higher than the monotherapy groups, which indicated that garlic oil could enhance the destructive effects on inner membranes against ESBL E. coli. Furthermore, the high level of garlic oil (0.5 MIC) combined with the same level of cefquinome exhibited more effective destruction on inner membranes, which inferred that the destructive effects of the combination of garlic oil and cefquinome on the inner membrane were dose dependent.
On the other hand, NPN staining is a method to detect the permeability of cell outer membranes. When the permeability of cell outer membrane decreases, the NPN would combine with the hydrophobic parts of the phospholipid bilayer and release fluorescence. As shown in Figure 6B, the FI in combination groups was also significantly higher than the monotherapy groups, and simultaneously, the FI in the combination group with 0.5 MIC garlic oil was higher than the group with 0.25 MIC garlic oil, which suggested that garlic oil had the ability to reduce the permeability of the ESBL E. coli outer membrane.
Thus, results of PI and NPN staining indicated that garlic oil could enhanced the ability of cefquinome to destroy either the inner membrane or outer membrane of ESBL E. coli, which suggested that garlic oil may be an effective antibiotic enhancer.
2.8. Scanning Electron Microscope (SEM)
To verify garlic oil can enhance the ability of cefquinome to destroy the cell inner and out membrane of ESBL E. coli, scanning electron microscopy (SEM) was used to observe the morphological changes in one ESBL E. coli (ZZ4) after treatment with garlic oil. As shown in Figure 7, the surface of cells treated with cefquinome combined with garlic oil showed depression, shrinkage, and even collapse and lysis compared with monotreatment and the negative control treatment, indicating that the antibacterial effect of garlic oil may be related to the rapid destruction of cell surface structure.
3. Discussion
The emergence of ESBL E. coli has become a worldwide public health concern [5]. Numerous surveillance studies of ESBL bacteria in human and veterinary medicine have demonstrated that ESBL E. coli is associated with an increased risk of transmission and poses a significant threat to the sale of food products and public health [21,22]. To understand the current situation of ESBL E. coli, we examined the presence of 10 ESBL genes in 80 E. coli strains isolated from seven cities from different areas of China, including Shenyang (northeastern China), Lanzhou (northwestern China), Tangshan (northern China), Zhengzhou (middle of China), Shanghai (eastern China), Kunming (southwestern China), and Guangzhou (southern China). To the best of our knowledge, this is a very rare study on the prevalence of ESBLs on such a large geographical scale (Figure 2E).
The results of this study showed that the rate of ESBL E. coli was similar with previous studies in China [4,23]. However, the rates in different cities were totally different. For example, the ESBL rate in Shenyang was 76.19%, but the rate in Shanghai was 21.43%, which is nearly three times the difference between them. However, the rates in Guangzhou and Tangshan were similar at 60%. This phenomenon was also observed in our previous study [20]. In that study, we tried to raise several hypotheses to explain it: firstly, after communicating with local veterinarians, the hypothesis that the variations may be related to local and individual medication habits was verified. For instance, veterinarians in Shanghai preferred aminoglycosides such as amikacin and gentamycin to β-lactams such as ampicillin and ceftriaxone sodium during their daily practice. Thus, the rate of ESBL E. coli was lowest in Shanghai.
Secondly, we tested the hypothesis of geographical reason. The results of this study were compared with those of previous studies in China. We were surprised to find regional differences in the detection rate of ESBLs and the types of ESBL E. coli compared with previous studies [24,25]. However, a detailed phylogenetic comparison found that such geographical differences do not seem to be verified in this study. Nevertheless, we found that there were major epidemics in different cities, for example, the major epidemics of ESBL E. coli in Shenyang was CTX-M-1, while in Tangshan it was CTX-M-15. Combined with previous studies in a number of other countries, ESBL E. coli was found to be endemic to CTX-M-1 in France, OXA-48 in Switzerland, and CTX-M-8 in Brazil [26,27,28]. Therefore, we revised our former hypothesis: the prevalence does depend on geography, and the type of epidemic is geographical.
Public policies may be another factor that could affect the prevalence of ESBL E. coli. In Europe, with guidelines on the prudent use of antimicrobial veterinary medicines published in 2015, the rates of ESBLs were relatively lower compared with China where appeals to reduce and replace antibiotics with other agents in veterinary medicine did not occur until 2020 [29,30,31,32]. The degree of social and economic development can also affect the prevalence of antibiotic resistance. It is clear that the ESBL rate in Shanghai, which is the most developed city in this study, was lowest. Furthermore, compared with previous studies in Africa and west Asia [33,34,35], the rates of ESBL genes in this study were lower. The impact of social and economic development can also be verified through comparisons with wealthier regions. The rates of ESBL-resistant genes in this study were slightly higher than the rates in west Europe and the United States [36,37,38,39].
In summary, four hypotheses may influence the prevalence of feline-origin ESBL E. coli: 1. local and individual medication habits; 2. geographic factors; 3. public policies; and 4. the degree of social and economic development. These hypotheses should be verified continuously in a follow-up study.
As previous studies found, garlic oil exhibited great antibacterial activity in vivo and vitro [40,41,42], and the activity was also verified in this study. However, unexpectedly, we found that garlic oil exhibited potent potentiation (4- to 16-fold) of the effectiveness of cefquinome against ESBL E. coli in a stable concentration (256~1024 μg/mL). To our knowledge, this study is the first to report the effect of the combination of garlic oil and cefquinome in inhibiting ESBL E. coli. Furthermore, to determine whether the antibacterial effect is related to garlic oil dose, we evaluated the bactericidal activity of high levels (0.5 MIC) of garlic oil combined with cefquinome. As indicated by time-kill curve analyses, the dose dependence was verified. The activity of garlic oil in inhibiting bacterial proliferation was also confirmed by the growth curve. Moreover, after continuous treatment with garlic oil, the MICs of ESBL E. coli to cefquinome decreased significantly. The significant decreases were proven to be related to two factors (generation and treatment of garlic oil) by two-way ANOVA test, and the interaction of two factors was confirmed. The above results clearly indicate that the combination of garlic oil and cefquinome has great antibacterial effects against ESBL E. coli, and more importantly, it is possible to reduce antibiotic resistance through continuous use of combinations of herbal extracts and antibiotics.
The cell membrane plays an important role in the metabolism and proliferation of bacteria [43,44], and previous studies found that bacteria was killed by cefquinome through damaging the cell membrane [45]. As a result of that, we hypothesized that there was a bactericidal effect by enhancing the cell membrane destruction effect of cefquinome when we combined garlic oil and cefquinome, which caused metabolic and replication disorders. To confirm our hypothesis, we tried to find some other previous studies on the antibacterial effect of plant extracts by altering membrane permeability. In the study on tetracycline and quercetin against multiple-drug-resistant E. coli, researchers found that the combination can kill MDR E. coli by altering cell membrane permeability [10], and moreover, they found that intracellular ATP levels decreased under the exposure of quercetin combined with tetracycline, which is consistent with our conjectures about the effect of drug combination on bacterial metabolism. Another two previous studies have found combinations of antibiotics and plant extracts can damage the integrity of cell membranes, thereby affecting their growth and proliferation and have a bactericidal effect [46,47], which fits our hypothesis about the effect of drug combination on bacterial replication.
Although it has been shown that the bacteriostatic effect would be achieved by damaging the integrity of cell membranes, the current studies are only apparent studies, and the mechanism of drug combinations damaging cell membranes has not yet been fully explored. Below are our hypotheses for possible patterns of drug combinations that damage cell membranes.
To study the possible mechanism of the antibacterial effect of garlic oil combined with cefquinome, we evaluated the cell membrane destruction activity of the combination through PI, NPN staining, and SEM, as conducted in a previous study [48]. After being treated with the garlic oil and cefquinome together, the permeability and integrity of both outer and inner membranes were damaged significantly and the destruction effects were proved to be garlic oil dose dependent, which preliminarily proved that the bactericidal effect might be related to the destruction of cell membranes, and the hypothesis was further proved through direct observation by SEM. As shown in Figure 7 and described in Figure 8, both the inner and outer membrane were complete and fluid in negative control and the plasmid DNA could not outflow. In cefquinome treatment, the outer membrane became smoother (shown in Figure 7), the permeability of the outer membrane decreased, and phospholipid gap enlarged (described in Figure 8), but the inner membrane was still complete, which we assumed was related to the hydrolytic action of ESBL enzymes in the periplasm. In garlic oil treatment, bean-shaped bulges that may be caused by the phospholipids affinity with garlic oil molecules occurred on the surface of the cell membrane, which contributed to enlargement of phospholipid gaps. In the combination treatment, the simultaneous action of garlic oil and cefquinome on the outer membrane caused significant damage to the outer membrane of the cell, resulting in a lot of cefquinome molecules entering the membrane gap, so the ESBLs could not hydrolyze cefquinome immediately. The cefquinome and garlic oil then interact with the inner membrane simultaneously, resulting in severe damage to the inner membrane, contributing to the destruction of ATP synthesis site and DNA outflow. As a result, metabolism and replication of bacteria were disrupted and the bacteria were killed. All hypotheses were based on the results of PI staining, NPN staining, and direct observation through SEM. However, the above hypotheses are still only based on the direct observation of a combination of garlic oil and cefquinome damaging cell membranes. Specific mechanisms should be further explored by transcriptome sequencing and other methods.
This study aimed to find a new method to fight ESBL E. coli infection in veterinary practice. Whether garlic oil can be used on cats was predicted by referring to several previous studies. First, whether garlic oil is poisonous to cats is the most important factor that should be taken into account. As described by other researchers, onion does show toxicity to cats because of dipropyl disulfide which is alike in structure to garlic oil at a dose of 5 g/kg [10], so we speculate that garlic oil may not be toxic to cats in certain doses. To verify our guess, we found another study which found that allicin (garlic oil in solid form) can improve the hemorheology of cats during anesthesia at a dose of 0.1 to 1 mg/kg, which is far below the toxic dose [49,50]. Combined with the results of antibacterial tests in vitro in this study, we speculated that doses of garlic oil combined with cefquinome would be far below the toxic dose. However, more clinical trials are needed to confirm whether the use of garlic oil on cats for bacterial infectious diseases is safe. Secondly, due to its unique odor and pungent taste, garlic oil still needs to find an effective method of flavor correction before it can be used in veterinary practice.
Although we have demonstrated the existence of ESBL E. coli in cats in different areas of China from feline fecal samples, to understand well the prevalence of feline origin ESBL E. coli better in China, the scale, scope, and time span of sampling can be expanded. The specific mechanism of drug combination on cell membrane destruction remains to be studied. Most importantly, the safe and effective dose to treat ESBL E. coli infection needs to be studied carefully.
This study has some limitations. First, the sample size in the different cities was relatively small; thus, larger samples will be needed to verify the four above-mentioned hypotheses. Second, despite the observed synergism of the combination of garlic oil and cefquinome, the mechanism of the synergy remains to be explored. Transcriptome sequencing has been used in drug-resistance reduction studies to identify changes in the expression of drug-resistance genes, data which can in turn be used in further studies to elucidate the effect of garlic oil on damaging cell membranes and the expression of ESBL genes. Furthermore, molecular docking and Western blotting can be used to evaluate the inhibitory effects of drugs on the activity and expression of ESBLs and cell membrane proteins.
In conclusion, our data indicate that ESBL E. coli strains are present in notable rates in cats kept as pets in China, which may raise public health concerns. Our study also demonstrated the elimination effects of garlic oil on cefquinome against ESBL E. coli. However, the mechanism of this synergistic activity remains to be elucidated in future studies. The discovery of garlic oil as a novel cefquinome adjuvant highlights the enormous antibacterial potential of compounds extracted from herbs.
4. Materials and Methods
4.1. Sample Collection
In this cross-sectional study, 103 feline-origin fecal samples were collected from 10 animal hospitals in 7 cities from different areas in China (Shenyang—northeast China, Tangshan—north China, Zhengzhou—middle of China, Lanzhou—northwest China, Shanghai—east China, Guangzhou—south China, and Kunming—southwest China) from September 2022 to February 2023, which were numbered by the first letter of the sampling city and the patient number.
4.2. Bacterial Isolation and Molecular Confirmation
All collected samples were enriched in trypticase soy broth for 10~12 h at 37 °C until reaching the logarithmic phase and then transferred onto MacConkey agar and then eosin-methylene blue agar and incubated aerobically for 16~18 h at 37 °C. One characteristic colony from each sample (red isolates on MacConkey agar an the black with metallic luster isolates) was selected and saved for the next steps. The E. coli isolates were subjected to Gram staining followed by primary identification. All media were purchased from Qingdao Hope Biotechnology Co., Qingdao, China. The E. coli strain ATCC® 25922™ preserved in our laboratory was used as a control.
Single, pure isolates were enriched for a second time in Mueller–Hinton broth (MHB) for 24 h at 37 °C. Thereafter, 1 mL of bacterial culture was centrifuged at 14,000 rpm for 15 min. After decanting the supernatant, the pelleted cells were washed with sterile ultrapure water, and the centrifugation and wash steps were repeated twice. To extract genomic DNA, washed bacteria were boiled in sterile ultrapure water for 10 min. After centrifugation at 14,000 rpm for 15 min, the resulting supernatant was used as the DNA template for polymerase chain reaction (PCR) assays [4,20] using primers specific for 16S rDNA to identify the isolates, as described previously [51,52,53]. PCR assays were performed in a final volume of 20 μL, consisting of 10 μL of master mix (Dining, Beijing, China), 1 μL of each forward and reverse primer, 1 μL of DNA template, and 7 μL of nuclease-free water. PCR assays were performed in a thermocycler (Bioer TC-XP-G, Hangzhou, China) using the following program: initial denaturation at 94 °C for 5 min, followed by 30 cycles of denaturation at 94 °C for 30 s, annealing (Table 3) for 30 s, extension at 72 °C for 30 s, followed by a final extension at 72 °C for 7 min. The positive and negative controls were E. coli ATCC® 25922™ and nuclease-free water, respectively. Electrophoresis was performed on a 1.5% agarose gel stained with DiRed Safe DNA DYE (Dining, China) to determine the size of PCR products compared to a 2000-bp DNA ladder. The gel was scanned using a UV-light transilluminator (72/BR04467, Bio-Rad, Hercules, CA, USA). Confirmed isolates were stored at −80 °C in MHB containing 35% glycerol until further analysis.
4.3. Antibiotic Susceptibility Testing
Broth-microdilution assays were performed to determine the antibiotic susceptibility and minimum inhibitory concentrations (MICs) for 9 β-lactam antibiotics and garlic oil (≥99%, Shanghai Macklin Biochemical Co., Ltd., Shanghai, China, Figure S1), including cefoxitin, ceftriaxone, ceftazidime, ceftriaxone, cefixime, cefquinome, meropenem, amoxicillin, and ampicillin (Shanghai Macklin Biochemical Co., Ltd., China) as recommended by the Clinical and Laboratory Standards Institute (CLSI 2023) and the European Committee on Antimicrobial Susceptibility Testing (EUCAST 2020) [55,56]. The above antibiotics are commonly used in veterinary clinical treatment of E. coli infection. Susceptibility to cefquinome was determined in reference to previous research [57]. All drugs were diluted 2-fold in MHB and mixed with an equal volume of bacterial suspension in a 96-well microtiter plate. Each test was repeated 3 times. Escherichia coli ATCC® 25922™ was used as the quality-control strain.
4.4. ESBL Confirmatory Test
The PCR method was used for the ESBL confirmatory test. All primers were reflected in Table 3. PCR assays were performed in a final volume of 20 μL consisting of 10 μL of master mix (Dining, China), 1 μL of each forward and reverse primer, 1 μL of DNA template, and 7 μL of nuclease-free water. PCR assays were performed in a thermocycler (Bioer TC-XP-G, China) using the following program: initial denaturation at 94 °C for 5 min, followed by 30 cycles of denaturation at 94 °C for 30 s, annealing (Table 1) for 30 s, extension at 72 °C for 30 s, followed by a final extension at 72 °C for 7 min. The primers refer to some previous studies [54,58,59,60,61,62,63,64]. The negative control was nuclease-free water. Electrophoresis was performed on a 1.5% agarose gel stained with DiRed Safe DNA DYE (Dining, China) to determine the size of PCR products compared to a 2,000-bp DNA ladder. The gel was scanned using a UV-light transilluminator (72/BR04467, Bio-Rad, Hercules, CA, USA). PCR positive products were sent to Tsingke Biotechnology Co., Ltd., Beijing, China. for sequencing and compared with the NCBI gene bank to confirm whether they were positive for ESBLs.
4.5. Checkerboard Assay
The combined antibacterial effect of garlic oil and cefquinome was assessed using a checkerboard assay, as previously described [65]. Briefly, both garlic oil and cefquinome were diluted to prepare 7 gradient concentrations ranging from 1/16 MIC to 2 MIC. Each longitudinal column of tubes contained the same concentration of drug A, and each horizontal row of tubes contained the same concentration of drug B. Each tube was inoculated with bacterial suspension to a final density of approximately 1 × 106 CFU/mL. Single-drug control tubes and blank control tubes were also prepared, and E. coli ATCC® 25922™ was used as a sensitivity control strain. Six ESBL isolates were used as experimental bacteria. All tubes were incubated at 37 °C for 16 h under aerobic conditions. The experiment was repeated in triplicate. The fractional inhibitory concentration index (FICI) was calculated according to the following formula (Table 4):
FICI = MIC of garlic oil in combination/MIC of garlic oil alone + MIC of cefquinome in combination/MIC of cefquinome alone.
In this study, synergy and partial synergy were defined as a synergistic relationship, whereas additive, indifferent, and antagonistic results were regarded as a non-synergistic relationship [66].
4.6. Time-Kill Curves
Time-kill assays were used to evaluate the antibacterial effects of the combination of garlic oil and cefquinome against ESBL E. coli by measuring the reduction in the calculated population in CFU/mL within 24 h. Garlic oil and cefquinome were incubated with an equal volume of E. coli culture at different levels of garlic oil and cefquinome [67]. As a control, MHB was added instead of garlic oil or cefquinome. All samples were cultivated at 37 °C. After 0, 2, 4, 6, 8, and 24 h of incubation, 100-μL samples were removed. After 10 rounds of centrifugation and resuspending to wash off residual medicine, proper dilutions were performed (Table 5), and 100 μL of each sample was spread onto Mueller–Hinton agar for colony counting. Each assay was repeated in triplicate.
4.7. Growth Curves
The growth curve was used to evaluate the growth inhibition effect of the combination on ESBL E. coli from the 7 h point until the logarithmic phase. Garlic oil and cefquinome were incubated with an equal volume of E. coli culture at 0.25 MIC of garlic oil and cefquinome. As a control, MHB was added instead of garlic oil or cefquinome. The starting concentration of bacterial culture was 1 × 106 CFU/mL. All samples were cultivated at 37 °C. Each hour during incubation, 100-μL samples were removed to measure the absorbance at OD600. Considering the emulsification of garlic oil, 5 tubes without isolates were also incubated. We plotted the curves with the absorbance changes at OD600 over time. Each assay was repeated in triplicate.
4.8. Drug-Resistance Curves
Drug-resistance curves were used to evaluate the effects of garlic oil in reducing the resistance of ESBL E. coli to cefquinome by determining the MIC after garlic oil treatment within 15 generations. Garlic oil (0.25 MIC) was incubated with an equal volume of each E. coli culture in MHB at 37 °C for 16 h. An inoculating loop of each MHB culture was then streaked onto Mueller–Hinton agar and incubated at 37 °C for 16 h. After 0, 1, 2, 3, 6, 9, and 15 generations, a single, pure colony of each isolate was removed and placed in MHB and incubated at 37 °C for 16 h, after which the MIC was determined. Each assay was repeated in triplicate.
4.9. PI Staining and NPN Staining
PI staining and NPN staining were used to evaluate the destructive effects of garlic oil combined with cefquinome on the inner and outer membrane of E. coli [48]. A fluorescence intensity of 10 nM propidium iodide (PI)-labeled E. coli incubated in MHB with garlic oil monotherapy, cefquinome monotherapy, or the combination of garlic oil and cefquinome was measured with the excitation wavelength of 535 nm and emission wavelength of 615 nm. The concentration of all above drugs was 0.25 MIC. As a control, MHB was added instead of garlic oil or cefquinome. The same operations were used in NPN (N-Phenyl-1-naphthylamine) staining, but the fluorescence intensity was measured with the excitation wavelength of 350 nm and emission wavelength of 420 nm.
4.10. Scanning Electron Microscope (SEM)
Isolates were incubated in MHB with 0.25 MIC garlic oil monotherapy, 0.25 MIC cefquinome monotherapy, or in the combination of 0.25 MIC garlic oil and 0.25 MIC cefquinome for 10 h. As a control, MHB was added instead of garlic oil or cefquinome. After 10 h, the bacteria were collected and washed by PBS. The bacteria were then fixed with 4% glutaraldehyde for 3 h. After that, the bacteria were dehydrated by using graded ethanol. Before beginning scanning electron microscopy, carbon dioxide critical point drying and a gold spraying operation were performed on the bacteria.
4.11. Statistical Analysis
Data are expressed as the mean ± standard deviation. The statistical significance of differences was determined using a 1-way ANOVA test in PI and NPN staining and a 2-way ANOVA test in drug-resistance curves with SPSS 27.0 software. For all comparisons, p < 0.01 and p < 0.05 were considered indicative of statistical significance. All figures were made by GraphPad Prism 8.0.1. The phylogenetic tree was drawn by Geneious Prime. The maps were downloaded from Standard Map Service accessed on 1 March 2023 (
Y.-C.T. designed and conducted the experiments. Y.-C.T., P.-C.L., Y.Y., Q.-Y.L., J.-T.L. and Y.-N.G. participated in the experiment process. Y.-C.T., Y.-N.Z. and S.J. analyzed the data and wrote the manuscript. S.-Z.Q. interpreted the study results. Some valuable suggestions were given to the experiment by F.-S.X., Y.-P.F. and Y.-Q.L.; W.-L.W., W.-R.M. and W.-M.Z. revised the manuscript. All authors have read and agreed to the published version of the manuscript.
The use of animals was approved by the institutional Animal Care and Use Committee and Ethics Committee of Northwest A&F University (approval number: NWLA-2021-063), and all cats were handled in accordance with the guidelines for laboratory animals of Animal Care and Use Committee of Northwest A&F University during sample collection. The animal study was reviewed and approved by the institutional Animal Care and Use Committee and Ethics Committee of Northwest A&F University (approval number: NWLA-2021-063). Written informed consent was obtained from the owners for the use of their animals in this study.
Informed consent was obtained from all owners of subjects involved in the study.
Data is contained within the article or
The authors thank the staff members of the animal hospitals who provided assistance with this study.
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
Footnotes
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.
Enlarge this image.Figure 1. Collection and isolation of feline-origin Escherichia coli in seven cities in China. (A) Rate of E. coli isolates; (B) geographic rate of E. coli isolates.
Enlarge this image.Figure 2. Results of ESBL detection of isolated E. coli. (A) Detection rates of 10 ESBL-resistant genes; (B) resistance of isolates to three kinds of β-lactam antibacterial drugs; (C) detection rate of ESBL E. coli in isolates; (D) rate of isolates with multiple ESBL genes; (E) geographic rate of ESBL E. coli isolates.
Enlarge this image.Figure 3. Phylogenetic tree of isolates carrying three groups of ESBL genes. (A) Genes in CTX-M-1 group; (B) genes in CTX-M-9 group; (C) genes in TEM group.
Enlarge this image.Figure 4. (A) Time-kill curves of garlic oil (GAR) and cefquinome (CEF) in different combinations or levels against ESBL E. coli. (B) Growth curves of ESBL E. coli treated with garlic oil (GAR) and cefquinome (CEF) in different combinations or levels.
Enlarge this image.Figure 5. Effect of garlic oil (GAR) on changing the sensitivity of ESBL E. coli to cefquinome. All data are expressed as mean ± SD determined from three independent experiments performed in triplicate and significance was determined by a two-way ANOVA test. ** p < 0.01; *** p < 0.001; **** p < 0.0001.
Enlarge this image.Figure 6. (A) Fluorescence intensity of PI staining of ESBL E. coli treated with garlic oil (GAR) and cefquinome (CEF) in different combinations or levels. (B) Fluorescence intensity of PI staining of ESBL E. coli treated with garlic oil (GAR) and cefquinome (CEF) in different combinations or levels. All data are expressed as mean ± SD determined from three independent experiments performed in triplicate and significance was determined by one-way ANOVA test. *** p < 0.001; **** p < 0.0001.
Enlarge this image.Figure 7. Morphological changes of ESBL E. coli (ZZ4) after different treatments. (A) Negative control; (B) 0.25MIC garlic oil (GAR); (C) 0.25MIC cefquinome (CEF); (D) 0.25MIC garlic oil (GAR) + 0.25MIC cefquinome (CEF).
Enlarge this image.Figure 8. The hypothesized mechanism picture of inhibition effect of garlic oil combined with cefquinome against ESBL E. coli by destroying cell membranes.
ESBL types of isolates.
| ESBL Genes Group | Isolates | Type | ESBL Genes Group | Isolates | Type |
|---|---|---|---|---|---|
| CTX-M-1 | GZ8 | CTX-M-1 | CTX-M-9 | LZ2-7 | CTX-M-27 |
| KM1 | CTX-M-1 | LZ2-8 | CTX-M-14 | ||
| KM2 | CTX-M-1 | LZ2-9 | CTX-M-104 | ||
| LZ2-6 | CTX-M-15 | SH2 | CTX-M-14 | ||
| QP4 | CTX-M-1 | SY13 | CTX-M-14 | ||
| SH3 | CTX-M-254 | SY14 | CTX-M-14 | ||
| SY10 | CTX-M-230 | SY16 | CTX-M-14 | ||
| SY12 | CTX-M-1 | SY18 | CTX-M-14 | ||
| SY13 | CTX-M-1 | SY19 | CTX-M-14 | ||
| SY20 | CTX-M-1 | SY20 | CTX-M-27 | ||
| SY22 | CTX-M-1 | SY22 | CTX-M-14 | ||
| SY3 | CTX-M-230 | ZZ1-1 | CTX-M-14 | ||
| SY4 | CTX-M-15 | ZZ3 | CTX-M-14 | ||
| SY5 | CTX-M-1 | ZZ5 | CTX-M-27 | ||
| SY6 | CTX-M-1 | ZZ6 | CTX-M-14 | ||
| SY7 | CTX-M-1 | TEM | LZ2-6 | TEM-116 | |
| SY8 | CTX-M-1 | SY13 | TEM-116 | ||
| SY9 | CTX-M-230 | SY14 | TEM-116 | ||
| TS5-2 | CTX-M-15 | SY16 | TEM-116 | ||
| TS6 | CTX-M-1 | SY18 | TEM-116 | ||
| TS7 | CTX-M-1 | SY19 | TEM-116 | ||
| TS8-2 | CTX-M-15 | SY4 | TEM-116 | ||
| ZZ4 | CTX-M-1 | SY9 | TEM-116 | ||
| ZZ7-1 | CTX-M-1 | TS8-1 | TEM-116 | ||
| ZZ8 | CTX-M-1 | ||||
| ZZ9 | CTX-M-1 |
FICI results of MIC (garlic oil) and FICI (garlic oil × cefquinome) for seven E. coli isolates.
| Strain | MIC (Alone)/μg/mL | MIC (Combined)/μg/mL | FICI | Outcome | ||
|---|---|---|---|---|---|---|
| Garlic Oil | Cefquinome | Garlic Oil | Cefquinome | |||
| ATCC® 25922TM | 512 | 0.5 | 128 | 0.125 | 0.5 | Synergy |
| ZZ4 | 1024 | 2048 | 128 | 128 | 0.1875 | Synergy |
| ZZ7-1 | 512 | 256 | 32 | 128 | 0.5625 | Additive effect |
| ZZ8 | 512 | 256 | 256 | 64 | 0.75 | Additive effect |
| ZZ9 | 512 | 2048 | 256 | 256 | 0.625 | Additive effect |
| TS5-2 | 512 | 256 | 64 | 32 | 0.25 | Synergy |
| TS6 | 512 | 1024 | 64 | 256 | 0.375 | Synergy |
| TS7 | 1024 | 2048 | 128 | 128 | 0.1875 | Synergy |
| GZ8 | 512 | 1024 | 64 | 256 | 0.375 | Synergy |
| SY4 | 128 | 512 | 32 | 32 | 0.3125 | Synergy |
| SY9 | 1024 | 8 | 512 | 2 | 0.75 | Additive effect |
| SY18 | 1024 | 8 | 256 | 2 | 0.5 | Synergy |
| SY19 | 512 | 16 | 128 | 2 | 0.375 | Synergy |
| SH2 | 1024 | 256 | 32 | 64 | 0.28125 | Synergy |
| LZ2-3 | 512 | 1024 | 64 | 128 | 0.25 | Synergy |
| GZ8 | 1024 | 2048 | 256 | 512 | 0.5 | Synergy |
| KM1 | 2048 | 256 | 256 | 128 | 0.625 | Additive effect |
Sequences of E. coli 16s rDNA and ESBL gene primers used in PCR assays.
| Gene | Sequence of Primer (5′~3′) | Size of Product/bp | Tm/°C | Reference |
|---|---|---|---|---|
| 16s rDNA | F:AGAGTTTGATCCTGGCTCAG | 306 | 55.0 | [ |
| R: CTTGTGCGGGCCCCCGTCAATTC | ||||
| CTX-M Family | F-ATGTGCAGYACCAGTAARGTKATGGC | 592 | 55.0 | [ |
| R-TGGGTRAARTARGTSACCAGAAYSAGCGG | ||||
| CTX-M-1 Group | F-ACCGCGATATCGTTGGT | 550 | 55.0 | [ |
| R-CGCTTTGCGATGTGCAG | ||||
| CTX-M-2 Group | F-ATGATGACTCAGAGCATTCG | 856 | 55.0 | [ |
| R-TCAGAAACCGTGGGTTACGA | ||||
| CTX-M-8 | F-GTGACAAAGAGAGTGCAACGG | 666 | 52.0 | [ |
| R-ATGATTCTCGCCGCTGAAGCC | ||||
| CTX-M-9 Group | F-GCACGATGACATTCGGG | 857 | 52.0 | [ |
| R-AACCCACGATGTGGGTAGC | ||||
| TEM Group | F-ATGAGTATTCAACATTTCCG | 858 | 55.0 | [ |
| R-CCAATGCTTAATCAGTGAGG | ||||
| SHV Group | F-ATGAGTATTCAACATTTTCG | 841 | 55.0 | [ |
| R-TTACCAATGCTTAATCAGTG | ||||
| OXA-1 | F-ATGCGTTATATTCGCCTGTG | 820 | 55.0 | [ |
| R-TTAGCGTTGCCAGTGCTCGA | ||||
| OXA-2 | F-ATGAAAAACACAATACATATCAACTTCGC | 601 | 55.0 | [ |
| R-GTGTGTTTAGAATGGTGATCGCATT | ||||
| OXA-10 | F-ACGATAGTTGTGGCAGACGAAC | 277 | 55.0 | [ |
| R-ATYCTGTTTGGCGTATCRATATTC |
FICI values and criteria definitions.
| FICI | Meaning |
|---|---|
| FICI ≤ 0.5 | Synergistic effect |
| 0.5 < FICI ≤ 0.75 | Partial synergistic effect |
| 0.75 < FICI ≤ 1 | Additive effect |
| 1 < FICI ≤ 4 | Indifferent effect |
| FICI > 4 | Antagonism |
Bacterial solution dilution ratio in time-kill curves.
| Group | Incubation Time/h | Isolates | Dilution Ratio |
|---|---|---|---|
| Positive control | 0 | TS7, ZZ4 and SH2 | 105 |
| 2 | TS7, ZZ4 and SH2 | 105 | |
| 4 | TS7, ZZ4 and SH2 | 107 | |
| 6 | TS7, ZZ4 and SH2 | 109 | |
| 8 | TS7, ZZ4 and SH2 | 109 | |
| 24 | TS7, ZZ4 and SH2 | 109 | |
| CEF | 0 | TS7, ZZ4 and SH2 | 105 |
| 2 | TS7, ZZ4 and SH2 | 105 | |
| 4 | TS7 and ZZ4 | 106 | |
| SH2 | 104 | ||
| 6 | TS7 and ZZ4 | 106 | |
| SH2 | 104 | ||
| 8 | TS7 and ZZ4 | 109 | |
| SH2 | 107 | ||
| 24 | TS7 and ZZ4 | 106 | |
| SH2 | 105 | ||
| GAR | 0 | TS7, ZZ4 and SH2 | 105 |
| 2 | TS7, ZZ4 and SH2 | 105 | |
| 4 | TS7, ZZ4 and SH2 | 105 | |
| 6 | TS7, ZZ4 and SH2 | 105 | |
| 8 | TS7, ZZ4 and SH2 | 105 | |
| 24 | TS7, ZZ4 and SH2 | 106 | |
| COM (low) | 0 | TS7, ZZ4 and SH2 | 105 |
| 2 | TS7 and ZZ4 | 105 | |
| SH2 | 104 | ||
| 4 | TS7 and ZZ4 | 104 | |
| SH2 | 103 | ||
| 6 | TS7 and SH2 | 103 | |
| ZZ4 | 104 | ||
| 8 | TS7 and SH2 | 103 | |
| ZZ4 | 104 | ||
| 24 | TS7 and SH2 | 103 | |
| ZZ4 | 104 | ||
| COM (high) | 0 | TS7, ZZ4 and SH2 | 106 |
| 2 | TS7, ZZ4 and SH2 | 104 | |
| 4 | TS7, ZZ4 and SH2 | 101 | |
| 6 | TS7, ZZ4 and SH2 | 100 | |
| 8 | TS7, ZZ4 and SH2 | 100 | |
| 24 | TS7, ZZ4 and SH2 | 100 |
Supplementary Materials
The following supporting information can be downloaded at:
References
1. Carvalho, A.C.; Barbosa, A.V.; Arais, L.R.; Ribeiro, P.F.; Carneiro, V.C.; Cerqueira, A.M. Resistance patterns, ESBL genes, and genetic relatedness of Escherichia coli from dogs and owners. Braz. J. Microbiol.; 2016; 47, pp. 150-158. [DOI: https://dx.doi.org/10.1016/j.bjm.2015.11.005] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/26887238]
2. Jang, J.; Hur, H.G.; Sadowsky, M.J.; Byappanahalli, M.N.; Yan, T.; Ishii, S. Environmental Escherichia coli: Ecology and public health implications—A review. J. Appl. Microbiol.; 2017; 123, pp. 570-581. [DOI: https://dx.doi.org/10.1111/jam.13468] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/28383815]
3. Rybolt, L.E.; Sabunwala, S.; Greene, J.N. Zoonotic bacterial respiratory infections associated with cats and dogs: A case series and literature review. Cureus; 2022; 14, e24414. [DOI: https://dx.doi.org/10.7759/cureus.24414] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/35619868]
4. Chen, Y.; Liu, Z.; Zhang, Y.; Zhang, Z.; Lei, L.; Xia, Z. Increasing prevalence of ESBL-producing multidrug resistance Escherichia coli from diseased pets in Beijing, China from 2012 to 2017. Front. Microbiol.; 2019; 10, 2852. [DOI: https://dx.doi.org/10.3389/fmicb.2019.02852]
5. Tamma, P.D.; Aitken, S.L.; Bonomo, R.A.; Mathers, A.J.; van Duin, D.; Clancy, C.J. Infectious Diseases Society of America Guidance on the Treatment of Extended-Spectrum β-lactamase Producing Enterobacterales (ESBL-E), Carbapenem-Resistant Enterobacterales (CRE), and Pseudomonas aeruginosa with Difficult-to-Treat Resistance (DTR-P. aeruginosa). Clin. Infect. Dis.; 2021; 72, pp. e169-e183. [DOI: https://dx.doi.org/10.1093/cid/ciaa1478]
6. Porras, G.; Chassagne, F.; Lyles, J.T.; Marquez, L.; Dettweiler, M.; Salam, A.M. Ethnobotany and the role of plant natural products in antibiotic drug discovery. Chem. Rev.; 2021; 121, pp. 3495-3560. [DOI: https://dx.doi.org/10.1021/acs.chemrev.0c00922]
7. Munita, J.M.; Arias, C.A. Mechanisms of antibiotic resistance. Microbiol. Spectr.; 2016; 4, 10. [DOI: https://dx.doi.org/10.1128/microbiolspec.VMBF-0016-2015]
8. Christaki, E.; Marcou, M.; Tofarides, A. Antimicrobial resistance in bacteria: Mechanisms, evolution, and persistence. J. Mol. Evol.; 2020; 88, pp. 26-40. [DOI: https://dx.doi.org/10.1007/s00239-019-09914-3]
9. Oyedemi, B.O.; Shinde, V.; Shinde, K.; Kakalou, D.; Stapleton, P.D.; Gibbons, S. Novel R-plasmid conjugal transfer inhibitory and antibacterial activities of phenolic compounds from Mallotus philippensis (Lam.). Mull. Arg. J. Glob. Antimicrob. Resist.; 2016; 5, pp. 15-21. [DOI: https://dx.doi.org/10.1016/j.jgar.2016.01.011]
10. Qu, S.; Dai, C.; Shen, Z.; Tang, Q.; Wang, H.; Zhai, B.; Zhao, L.; Hao, Z. Mechanism of synergy between tetracycline and quercetin against antibiotic resistant Escherichia coli. Front. Microbiol.; 2019; 10, 2536. [DOI: https://dx.doi.org/10.3389/fmicb.2019.02536]
11. Shi, C.; Bao, J.; Sun, Y.; Kang, X.; Lao, X.; Zheng, H. Discovery of Baicalin as NDM-1 inhibitor: Virtual screening, biological evaluation and molecular simulation. Bioorg. Chem.; 2019; 88, 102953. [DOI: https://dx.doi.org/10.1016/j.bioorg.2019.102953] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/31077911]
12. Peng, L.Y.; Yuan, M.; Wu, Z.M.; Song, K.; Zhang, C.L.; An, Q. Anti-bacterial activity of baicalin against APEC through inhibition of quorum sensing and inflammatory responses. Sci. Rep.; 2019; 9, 4063. [DOI: https://dx.doi.org/10.1038/s41598-019-40684-6] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/30858423]
13. Hwang, D.; Lim, Y.H. Resveratrol controls Escherichia coli growth by inhibiting the AcrAB-TolC efflux pump. FEMS Microbiol. Lett.; 2019; 366, fnz030. [DOI: https://dx.doi.org/10.1093/femsle/fnz030] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/30753439]
14. Zhang, L.; Qu, Z.; Song, A.; Yang, J.; Yu, J.; Zhang, W.; Zhuang, C. Garlic oil blocks tobacco carcinogen 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone (NNK)-induced lung tumorigenesis by inducing phase II drug-metabolizing enzymes. Food Chem. Toxicol.; 2021; 157, 112581. [DOI: https://dx.doi.org/10.1016/j.fct.2021.112581]
15. Tain, Y.L.; Hou, C.Y.; Chang-Chien, G.P.; Lin, S.; Hsu, C.N. Perinatal Garlic Oil Supplementation Averts Rat Offspring Hypertension Programmed by Maternal Chronic Kidney Disease. Nutrients; 2022; 14, 4624. [DOI: https://dx.doi.org/10.3390/nu14214624] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/36364887]
16. Kuna, L.; Zjalic, M.; Kizivat, T.; Roguljic, H.; Nincevic, V.; Omanovic Kolaric, T.; Wu, C.H.; Vcev, A.; Smolic, M.; Smolic, R. Pretreatment of Garlic Oil Extracts Hampers Epithelial Damage in Cell Culture Model of Peptic Ulcer Disease. Medicina; 2022; 58, 91. [DOI: https://dx.doi.org/10.3390/medicina58010091]
17. Liu, M.; Pan, Y.; Feng, M.; Guo, W.; Fan, X.; Feng, L.; Huang, J.; Cao, Y. Garlic essential oil in water nanoemulsion prepared by high-power ultrasound: Properties, stability and its antibacterial mechanism against MRSA isolated from pork. Ultrason. Sonochem.; 2022; 90, 106201. [DOI: https://dx.doi.org/10.1016/j.ultsonch.2022.106201]
18. Ashrit, P.; Sadanandan, B.; Shetty, K.; Vaniyamparambath, V. Polymicrobial Biofilm Dynamics of Multidrug-Resistant Candida albicans and Ampicillin-Resistant Escherichia coli and Antimicrobial Inhibition by Aqueous Garlic Extract. Antibiotics; 2022; 11, 573. [DOI: https://dx.doi.org/10.3390/antibiotics11050573]
19. Jinno, C.; Kim, K.; Wong, B.; Wall, E.; Sripathy, R.; Liu, Y. Dietary Supplementation with Botanical Blends Modified Intestinal Microbiota and Metabolomics of Weaned Pigs Experimentally Infected with Enterotoxigenic Escherichia coli. Microorganisms; 2023; 11, 320. [DOI: https://dx.doi.org/10.3390/microorganisms11020320]
20. Tong, Y.C.; Zhang, Y.N.; Li, P.C.; Cao, Y.L.; Ding, D.Z.; Yang, Y.; Lin, Q.Y.; Gao, Y.N.; Sun, S.Q.; Fan, Y.P. et al. Detection of antibiotic-resistant canine origin Escherichia coli and the synergistic effect of magnolol in reducing the resistance of multidrug-resistant Escherichia coli. Front. Vet. Sci.; 2023; 10, 1104812. [DOI: https://dx.doi.org/10.3389/fvets.2023.1104812]
21. Liao, K.; Chen, Y.; Wang, M.; Guo, P.; Yang, Q.; Ni, Y. Molecular characteristics of extended-spectrum β-lactamase-producing Escherichia coli and Klebsiella pneumoniae causing intra-abdominal infections from 9 tertiary hospitals in China. Diagn. Microbiol. Infect. Dis.; 2017; 87, pp. 45-48. [DOI: https://dx.doi.org/10.1016/j.diagmicrobio.2016.10.007] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/27773544]
22. Chong, Y.; Shimoda, S.; Shimono, N. Current epidemiology, genetic evolution and clinical impact of extended-spectrum β-lactamase-producing Escherichia coli and Klebsiella pneumoniae. Infect. Genet. Evol.; 2018; 61, pp. 185-188. [DOI: https://dx.doi.org/10.1016/j.meegid.2018.04.005] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/29626676]
23. Sun, Y.; Zeng, Z.; Chen, S.; Ma, J.; He, L.; Liu, Y.; Deng, Y.; Lei, T.; Zhao, J.; Liu, J.H. High prevalence of bla(CTX-M) extended-spectrum β-lactamase genes in Escherichia coli isolates from pets and emergence of CTX-M-64 in China. Clin. Microbiol. Infect.; 2010; 16, pp. 1475-1481. [DOI: https://dx.doi.org/10.1111/j.1469-0691.2010.03127.x]
24. Sun, L.; Meng, N.; Wang, Z.; Hong, J.; Dai, Y.; Wang, Z.; Wang, J.; Jiao, X. Genomic Characterization of ESBL/AmpC-Producing Escherichia coli in Stray Dogs Sheltered in Yangzhou, China. Infect. Drug Resist.; 2022; 15, pp. 7741-7750. [DOI: https://dx.doi.org/10.2147/IDR.S397872]
25. Zhou, Y.; Ji, X.; Liang, B.; Jiang, B.; Li, Y.; Yuan, T. Antimicrobial resistance and prevalence of extended spectrum β-lactamase-producing Escherichia coli from dogs and cats in northeastern China from 2012 to 2021. Antibiotics; 2022; 11, 1506. [DOI: https://dx.doi.org/10.3390/antibiotics11111506]
26. Gruel, G.; Couvin, D.; Guyomard-Rabenirina, S.; Arlet, G.; Bambou, J.C.; Pot, M.; Roy, X.; Talarmin, A.; Tressieres, B.; Ferdinand, S. et al. High Prevalence of blaCTXM-1/IncI1-Iγ/ST3 Plasmids in Extended-Spectrum β-Lactamase-Producing Escherichia coli Isolates Collected From Domestic Animals in Guadeloupe (French West Indies). Front. Microbiol.; 2022; 13, 882422. [DOI: https://dx.doi.org/10.3389/fmicb.2022.882422] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/35651489]
27. Dazio, V.; Nigg, A.; Schmidt, J.S.; Brilhante, M.; Mauri, N.; Kuster, S.P.; Brawand, S.G.; Schüpbach-Regula, G.; Willi, B.; Endimiani, A. et al. Acquisition and carriage of multidrug-resistant organisms in dogs and cats presented to small animal practices and clinics in Switzerland. J. Vet. Intern. Med.; 2021; 35, pp. 970-979. [DOI: https://dx.doi.org/10.1111/jvim.16038] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/33527554]
28. Silva, M.M.; Sellera, F.P.; Fernandes, M.R.; Moura, Q.; Garino, F.; Azevedo, S.S.; Lincopan, N. Genomic features of a highly virulent, ceftiofur-resistant, CTX-M-8-producing Escherichia coli ST224 causing fatal infection in a domestic cat. J. Glob. Antimicrob. Resist.; 2018; 15, pp. 252-253. [DOI: https://dx.doi.org/10.1016/j.jgar.2018.10.023] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/30404045]
29. Zhou, W.; Lin, R.; Zhou, Z.; Ma, J.; Lin, H.; Zheng, X. Antimicrobial resistance and genomic characterization of Escherichia coli from pigs and chickens in Zhejiang, China. Front. Microbiol.; 2022; 13, 1018682. [DOI: https://dx.doi.org/10.3389/fmicb.2022.1018682] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/36353453]
30. Hordijk, J.; Schoormans, A.; Kwakernaak, M.; Duim, B.; Broens, E.; Dierikx, C.; Mevius, D.; Wagenaar, J.A. High prevalence of fecal carriage of extended spectrum β-lactamase/AmpC-producing Enterobacteriaceae in cats and dogs. Front. Microbiol.; 2013; 4, 242. [DOI: https://dx.doi.org/10.3389/fmicb.2013.00242]
31. Ortiz-Díez, G.; Mengíbar, R.L.; Turrientes, M.C.; Artigao, M.B.; Gallifa, R.L.; Tello, A.M.; Pérez, C.F.; Santiago, T.A. Prevalence, incidence and risk factors for acquisition and colonization of extended-spectrum beta-lactamase- and carbapenemase-producing Enterobacteriaceae from dogs attended at a veterinary hospital in Spain. Comp. Immunol. Microbiol. Infect. Dis.; 2023; 92, 101922. [DOI: https://dx.doi.org/10.1016/j.cimid.2022.101922]
32. Schmidt, V.M.; Pinchbeck, G.L.; Nuttall, T.; McEwan, N.; Dawson, S.; Williams, N.J. Antimicrobial resistance risk factors and characterisation of faecal E. coli isolated from healthy Labrador retrievers in the United Kingdom. Prev. Vet. Med.; 2015; 119, pp. 31-40. [DOI: https://dx.doi.org/10.1016/j.prevetmed.2015.01.013] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/25732912]
33. Qekwana, D.N.; Phophi, L.; Naidoo, V.; Oguttu, J.W.; Odoi, A. Antimicrobial resistance among Escherichia coli isolates from dogs presented with urinary tract infections at a veterinary teaching hospital in South Africa. BMC Vet. Res.; 2018; 14, 228. [DOI: https://dx.doi.org/10.1186/s12917-018-1552-7] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/30064417]
34. Tudu, R.; Banerjee, J.; Habib, M.; Bandyopadhyay, S.; Biswas, S.; Kesh, S.S.; Maity, A.; Batabyal, S.; Polley, S. Prevalence and molecular characterization of extended-spectrum β-lactamase (ESBL) producing Escherichia coli isolated from dogs suffering from diarrhea in and around Kolkata. Iran. J. Vet. Res.; 2022; 23, pp. 237-246. [DOI: https://dx.doi.org/10.22099/IJVR.2022.42543.6176] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/36425605]
35. Habibzadeh, N.; Peeri Doghaheh, H.; Manouchehri Far, M.; Alimohammadi Asl, H.; Iranpour, S.; Arzanlou, M. Fecal Carriage of Extended-Spectrum β-Lactamases and pAmpC Producing Enterobacterales in an Iranian Community: Prevalence, Risk Factors, Molecular Epidemiology, and Antibiotic Resistance. Microb. Drug Resist.; 2022; 28, pp. 921-934. [DOI: https://dx.doi.org/10.1089/mdr.2021.0029] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/36067095]
36. Li, Y.; Fernández, R.; Durán, I.; Molina-López, R.A.; Darwich, L. Antimicrobial Resistance in Bacteria Isolated from Cats and Dogs From the Iberian Peninsula. Front. Microbiol.; 2021; 11, 621597. [DOI: https://dx.doi.org/10.3389/fmicb.2020.621597]
37. Carvalho, I.; Safia Chenouf, N.; Cunha, R.; Martins, C.; Pimenta, P.; Pereira, A.R.; Martínez-Álvarez, S.; Ramos, S.; Silva, V.; Igrejas, G. et al. Antimicrobial Resistance Genes and Diversity of Clones among ESBL- and Acquired AmpC-Producing Escherichia coli Isolated from Fecal Samples of Healthy and Sick Cats in Portugal. Antibiotics; 2021; 10, 262. [DOI: https://dx.doi.org/10.3390/antibiotics10030262]
38. Liu, X.; Thungrat, K.; Boothe, D.M. Occurrence of OXA-48 Carbapenemase and Other β-Lactamase Genes in ESBL-Producing Multidrug Resistant Escherichia coli from Dogs and Cats in the United States, 2009–2013. Front. Microbiol.; 2016; 7, 1057. [DOI: https://dx.doi.org/10.3389/fmicb.2016.01057]
39. McDanel, J.; Schweizer, M.; Crabb, V.; Nelson, R.; Samore, M.; Khader, K. Incidence of extended-spectrum β-lactamase (ESBL)-producing Escherichia coli and Klebsiella infections in the United States: A systematic literature review. Infect. Control Hosp. Epidemiol.; 2017; 38, pp. 1209-1215. [DOI: https://dx.doi.org/10.1017/ice.2017.156]
40. Avato, P.; Tursil, E.; Vitali, C.; Miccolis, V.; Candido, V. Allylsulfide constituents of garlic volatile oil as antimicrobial agents. Phytomedicine; 2000; 7, pp. 239-243. [DOI: https://dx.doi.org/10.1016/S0944-7113(00)80010-0]
41. Piletti, R.; Zanetti, M.; Jung, G.; de Mello, J.M.M.; Dalcanton, F.; Soares, C.; Riella, H.G.; Fiori, M.A. Microencapsulation of garlic oil by β-cyclodextrin as a thermal protection method for antibacterial action. Mater. Sci. Eng. C Mater. Biol. Appl.; 2019; 94, pp. 139-149. [DOI: https://dx.doi.org/10.1016/j.msec.2018.09.037]
42. Rodjan, P.; Wattanasit, S.; Thongprajukaew, K.; Faroongsarng, D. Effect of dietary coated granules containing garlic oil diallyl disulphide and diallyl trisulphide on performance, in vitro digestibility and gastrointestinal functionality in laying hens. J. Anim. Physiol. Anim. Nutr.; 2022; 106, pp. 118-131. [DOI: https://dx.doi.org/10.1111/jpn.13554]
43. Sielaff, H.; Duncan, T.M.; Börsch, M. The regulatory subunit ε in Escherichia coli FOF1-ATP synthase. Biochim. Biophys. Acta Bioenerg.; 2018; 1859, pp. 775-788. [DOI: https://dx.doi.org/10.1016/j.bbabio.2018.06.013] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/29932911]
44. Lakhani, M.; Azim, S.; Akhtar, S.; Ahmad, Z. Inhibition of Escherichia coli ATP synthase and cell growth by dietary pomegranate phenolics. Int. J. Biol. Macromol.; 2022; 213, pp. 195-209. [DOI: https://dx.doi.org/10.1016/j.ijbiomac.2022.05.111] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/35597381]
45. Gao, L.; Zhu, H.; Chen, Y.; Yang, Y. Antibacterial pathway of cefquinome against Staphylococcus aureus based on label-free quantitative proteomics analysis. J. Microbiol.; 2021; 59, pp. 1112-1124. [DOI: https://dx.doi.org/10.1007/s12275-021-1201-x] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/34751907]
46. Thakur, P.; Chawla, R.; Tanwar, A.; Chakotiya, A.S.; Narula, A.; Goel, R.; Arora, R.; Sharma, R.K. Attenuation of adhesion, quorum sensing and biofilm mediated virulence of carbapenem resistant Escherichia coli by selected natural plant products. Microb. Pathog.; 2016; 92, pp. 76-85. [DOI: https://dx.doi.org/10.1016/j.micpath.2016.01.001] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/26792674]
47. Wang, N.; Liu, X.; Li, J.; Zhang, Q.; Li, X.; An, Q.; Ye, X.; Zhao, Z.; Cai, L.; Han, Y. et al. Antibacterial mechanism of the synergistic combination between streptomycin and alcohol extracts from the Chimonanthus salicifolius S. Y. Hu. leaves. J. Ethnopharmacol.; 2020; 250, 112467. [DOI: https://dx.doi.org/10.1016/j.jep.2019.112467]
48. Yi, K.; Liu, S.; Liu, P.; Luo, X.; Zhao, J.; Yan, F.; Pan, Y.; Liu, J.; Zhai, Y.; Hu, G. Synergistic antibacterial activity of tetrandrine combined with colistin against MCR-mediated colistin-resistant Salmonella. Biomed. Pharmacother.; 2022; 149, 112873. [DOI: https://dx.doi.org/10.1016/j.biopha.2022.112873]
49. Cortinovis, C.; Caloni, F. Household Food Items Toxic to Dogs and Cats. Front. Vet. Sci.; 2016; 3, 26. [DOI: https://dx.doi.org/10.3389/fvets.2016.00026]
50. Kaye, A.D.; Nossaman, B.D.; Ibrahim, I.N.; Feng, C.J.; McNamara, D.B.; Agrawal, K.C.; Kadowitz, P.J. Analysis of responses of allicin, a compound from garlic, in the pulmonary vascular bed of the cat and in the rat. Eur. J. Pharmacol.; 1995; 276, pp. 21-26. [DOI: https://dx.doi.org/10.1016/0014-2999(94)00784-5]
51. Saki, M.; Amin, M.; Savari, M.; Hashemzadeh, M.; Seyedian, S.S. Beta-lactamase determinants and molecular typing of carbapenem-resistant classic and hypervirulent Klebsiella pneumoniae clinical isolates from southwest of Iran. Front. Microbiol.; 2022; 13, 9686. [DOI: https://dx.doi.org/10.3389/fmicb.2022.1029686]
52. Srivastava, S.; Singh, V.; Kumar, V.; Verma, P.C.; Srivastava, R.; Basu, V. Identification of regulatory elements in 16S rRNA gene of Acinetobacter species isolated from water sample. Bioinformation; 2008; 3, pp. 173-176. [DOI: https://dx.doi.org/10.6026/97320630003173] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/19238242]
53. Lin, H.; Chen, W.; Zhou, R.; Yang, J.; Wu, Y.; Zheng, J. Characteristics of the plasmid-mediated colistin-resistance gene mcr-1 in Escherichia coli isolated from a veterinary hospital in Shanghai. Front. Microbiol.; 2022; 13, 2827. [DOI: https://dx.doi.org/10.3389/fmicb.2022.1002827] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/36386648]
54. Dierikx, C.M.; van Duijkeren, E.; Schoormans, A.H.; van Essen-Zandbergen, A.; Veldman, K.; Kant, A.; Huijsdens, X.W.; van der Zwaluw, K.; Wagenaar, J.A.; Mevius, D.J. Occurrence and characteristics of extended-spectrum-β-lactamase- and AmpC-producing clinical isolates derived from companion animals and horses. J. Antimicrob. Chemother.; 2012; 67, pp. 1368-1374. [DOI: https://dx.doi.org/10.1093/jac/dks049]
55. Antimicrobial Susceptibility Testing System; European Committee on Antimicrobial Susceptibility Testing Peking Union Medical College Press: Beijing, China, 2022.
56. Performance Standards for Antimicrobial Susceptibility Testing; 33rd ed. Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2023.
57. Vilaró, A.; Novell, E.; Enrique-Tarancon, V.; Balielles, J.; Migura-García, L.; Fraile, L. Antimicrobial susceptibility testing of porcine bacterial pathogens: Investigating the prospect of testing a representative drug for each antimicrobial family. Antibiotics; 2022; 11, 638. [DOI: https://dx.doi.org/10.3390/antibiotics11050638]
58. Kojima, A.; Ishii, Y.; Ishihara, K.; Esaki, H.; Asai, T.; Oda, C.; Tamura, Y.; Takahashi, T.; Yamaguchi, K. Extended-spectrum-beta-lactamase-producing Escherichia coli strains isolated from farm animals from 1999 to 2002: Report from the Japanese Veterinary Antimicrobial Resistance Monitoring Program. Antimicrob. Agents Chemother.; 2005; 49, pp. 3533-3537. [DOI: https://dx.doi.org/10.1128/AAC.49.8.3533-3537.2005]
59. Briñas, L.; Moreno, M.A.; Zarazaga, M.; Porrero, C.; Sáenz, Y.; García, M.; Dominguez, L.; Torres, C. Detection of CMY-2, CTX-M-14, and SHV-12 beta-lactamases in Escherichia coli fecal-sample isolates from healthy chickens. Antimicrob. Agents Chemother.; 2003; 47, pp. 2056-2058. [DOI: https://dx.doi.org/10.1128/AAC.47.6.2056-2058.2003]
60. Gundran, R.S.; Cardenio, P.A.; Villanueva, M.A.; Sison, F.B.; Benigno, C.C.; Kreausukon, K.; Pichpol, D.; Punyapornwithaya, V. Prevalence and distribution of blaCTX-M, blaSHV, blaTEM genes in extended- spectrum β- lactamase- producing E. coli isolates from broiler farms in the Philippines. BMC Vet. Res.; 2019; 15, 227. [DOI: https://dx.doi.org/10.1186/s12917-019-1975-9]
61. Ibrahim, D.R.; Dodd, C.E.R.; Stekel, D.J.; Meshioye, R.T.; Diggle, M.; Lister, M.; Hobman, J.L. Multidrug-Resistant ESBL-Producing E. coli in Clinical Samples from the UK. Antibiotics; 2023; 12, 169. [DOI: https://dx.doi.org/10.3390/antibiotics12010169]
62. El-Badawy, M.F.; Tawakol, W.M.; Maghrabi, I.A.; Mansy, M.S.; Shohayeb, M.M.; Ashour, M.S. Iodometric and Molecular Detection of ESBL Production Among Clinical Isolates of E. coli Fingerprinted by ERIC-PCR: The First Egyptian Report Declares the Emergence of E. coli O25b-ST131clone Harboring blaGES. Microb. Drug Resist.; 2017; 23, pp. 703-717. [DOI: https://dx.doi.org/10.1089/mdr.2016.0181]
63. El Aila, N.A.; Al Laham, N.A.; Ayesh, B.M. Prevalence of extended spectrum beta lactamase and molecular detection of blaTEM, blaSHV and blaCTX-M genotypes among Gram negative bacilli isolates from pediatric patient population in Gaza strip. BMC Infect. Dis.; 2023; 23, 99. [DOI: https://dx.doi.org/10.1186/s12879-023-08017-1]
64. Bradford, P.A. Extended-spectrum beta-lactamases in the 21st century: Characterization, epidemiology, and detection of this important resistance threat. Clin. Microbiol. Rev.; 2001; 14, pp. 933-951. [DOI: https://dx.doi.org/10.1128/CMR.14.4.933-951.2001] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/11585791]
65. Draper, L.A.; Cotter, P.D.; Hill, C.; Ross, R.P. The two peptide lantibiotic lacticin 3147 acts synergistically with polymyxin to inhibit Gram negative bacteria. BMC Microbiol.; 2013; 13, 212. [DOI: https://dx.doi.org/10.1186/1471-2180-13-212]
66. Wang, Y.M.; Kong, L.C.; Liu, J.; Ma, H.X. Synergistic effect of eugenol with Colistin against clinical isolated Colistin-resistant Escherichia coli strains. Antimicrob. Resist. Infect. Control; 2018; 7, 17. [DOI: https://dx.doi.org/10.1186/s13756-018-0303-7] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/29423192]
67. Liu, Y.; Jia, Y.; Yang, K.; Li, R.; Xiao, X.; Zhu, K. Metformin restores tetracyclines susceptibility against multidrug resistant bacteria. Adv. Sci.; 2020; 7, 1902227. [DOI: https://dx.doi.org/10.1002/advs.201902227] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/32596101]
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/). Notwithstanding the ProQuest Terms and Conditions, you may use this content in accordance with the terms of the License.