Detection of mislabeling in packaged chicken sausages by PCR

Abstract

Considering that the authentication of food contents is one of the most important issues for the food quality sector, this study investigates processed-meat products from Italian markets and supermarkets using the mitochondrial cytochrome b gene qualitative PCR identification system in order to verify any species substitution or mislabeling. The results revealed a high substitution rate among the packaged chicken sausages, highlighting a mislabeling rate of 54%, and consequently, considerable discordance with the indications on the labels, which raises significant food-safety and consumer-protection concerns. The study also revealed important management implications, suggesting the need for implementation of effective and accurate monitoring and tracking programs

Headnote

Abstract:

Considering that the authentication of food contents is one of the most important issues for the food quality sector, this study investigates processed-meat products from Italian markets and supermarkets using the mitochondrial cytochrome b gene qualitative PCR identification system in order to verify any species substitution or mislabeling. The results revealed a high substitution rate among the packaged chicken sausages, highlighting a mislabeling rate of 54%, and consequently, considerable discordance with the indications on the labels, which raises significant food-safety and consumer-protection concerns. The study also revealed important management implications, suggesting the need for implementation of effective and accurate monitoring and tracking programs

Key words: packaged chicken sausages, speciesidentification, DNA-based method

1. Introduction

Food safety and quality is increasingly the focus of attention on the part of the food industry and of consumers. One of the main food quality-related issues is the authentication of food contents, as food products may be adulterated, and highly valuable species may be substituted, partially or entirely, by similar but cheaper ones. In the case of pork, food manufacturers may choose to use porcine derivatives because they are cheap and readily available [1] Porcine derivatives include pork fat (lard),mechanically recovered meats and porcine blood plasma [19] These practices are of concern for reasons such as: (i) economic, since it leads to unfair competition among producers; (ii) religious, since the consumption of certain species is not allowed in some religions; (iii) ethical, reflecting lifestyles such as vegetarianism; and (iv) health concerns.

Food authentication is a major worry not only in order to prevent commercial fraud, but also to assess the safety risks arising from the undeclared introduction of any food ingredient that might be harmful to human health, such as potentially allergenic or toxic compounds. [20].Indeed, a prevalence of beef, pork and chicken allergies has been reported [25, 6, 15].

Species identification is a major concern, due to increased consumer awareness regarding food composition and to the need to verify labeling statements. Processed-meat products are susceptible targets for fraudulent labeling due to the economic profit that results from selling cheaper meats as partial or total replacements for high-value ones [16, 22, 23]. In addition, the increasing demand for meat products in general may lead to deliberate adulteration along the food chain, by substituting high-quality species with lower-quality counterparts.

As stated in the introductory statement to Directive 2000/13/EC of the European Parliament and of the Council on the approximation of the laws of the Member States relating to the labeling, presentation and advertising of foodstuffs [11], "the prime consideration for any rules on the labeling of foodstuffs should be the need to inform and protect the consumer". Therefore, verification of declared components in food products is essential for the protection of consumer health [14, 3] but also to ensure fair trade and compliance with legislation [4, 19, 24].

Considering that the authentication of food contents is one of the most important points concerning food quality, and given the increasing demand for transparency in the meat industry following the horsemeat scandal in Europe, this study investigates processed-chicken meat products from Italian markets and supermarkets using the mitochondrial cytochrome b gene qualitative PCR identification system to verify any species substitution or mislabeling and consequently whether the contents match the labels.

2.Materials and Method

2.1.Reference materials

A 100% chicken processed sausage and a 100% pork processed sausage were used as positive controls. In order to assess the detection limit for the cytochrome b -PCR assay, bovine, chicken, pork and horse DNA at different percentages (0.5%, 1%, 2.5%, 5%) (target DNA/ non-target DNA) were used.

2.2. Sampling

A total of 80packaged chicken sausages, manufactured using chicken, were purchased from different Italian markets and supermarkets: the chicken sausage samples were labeled as chicken only and containing mechanically separated meat [12].The samples were stored at -20°C until processing.

2.3. DNA extraction and purification

Aliquots of each sample (25 mg) were subjected to DNA extraction and purification using the DNeasy® Tissue Kit (QIAGEN, Hilden, Germany). Briefly, aliquots (25 mg) of each meat sample added to 180 pi ATL lysis buffer and 20 pi of Proteinase K (20 mg/ ml) were incubated at 56 °C for 2 h. After adding 200 pi AL Buffer, the solution was mixed thoroughly by vortexing and incubated at 70°C for 10 min. The resulting mixture was then added with 200 pi ethanol (96-100%) and mixed by vortexing to yield a homogenous solution and transferred into the DNeasy® Mini spin column sitting in a 2 ml collection tube. The DNA, adsorbed into the QIA amp silica-gel membrane during subsequent centrifugation steps at 6000 g for 1 min, was washed using 500 pi AW1 and 500 pi AW2 washing buffers. Finally, the DNA was eluted with 200 pi of AE Elution Buffer (QIAGEN, Hilden, Germany). The DNA concentration and purity were established by evaluating the ratio A260nm/A280nm using a Beckman DU-640B Spectrophotometer.

2.4. Oligonucleotide primers

The oligonucleotide primers used in this study, described by Matsunaga et al. [18] and synthesized by PRIMM Sri (Milan, Italy), were the common forward primer SIM (5' GACCTCCCAGCTCCATCAAACA TCTCATCTTGATGAAA-3') and reverse primers, chicken primer C (5'-AAGATACAGATGAAG AAGAATGAGGCG-3 '), bovine primer B (5'CT AG AAAAGT GT AAG AC C C GT AAT AT AAG-3 ' ), pork primer P (5 ' -GCT GAT AGT GATTT GT GAT G ACC GTA-3') (Table. 1).

2.5. PCR assay

The PCR reactions were performed in a final volume of 25 pi, using 12.5 pi of HotStarTaq Master Mix 2X (QIAGEN, Hilden, Germany), containing 2.5 units of HotStarTaq DNA Polymerase, 1.5 mM of MgC12 and 200 pi of each dNTP. Then, 0.25 pM of each oligonucleotide primer and 2 pi of DNA were added. The amplification profile involved an initial dénaturation step at 95 °C for 15 min, followed by 35 cycles at 94 °C for 30 s, 58 °C for 30 s and 72 °C for 45 s. The positive and negative controls for the extraction and PCR were included. The PCR reactions were processed in a Mastercycler Personal (Eppendorf Milan, Italy). All reactions were performed in duplicate. The sequence analysis was carried out in order to confirm the specificity of the PCR assay. Sequencing reactions were performed by PRIMM Sri (Milan, Italy).

2.6. Detection of amplified products

PCR amplified products were analyzed by electrophoresis on 1.5% (w/v) agarose NA (Pharmacia, Uppsala, Sweden) gel in IX TBE buffer containing 0.089 M Tris, 0.089 M boric acid, 0.002 M EDTA, pH 8.0 (USB, Cleveland, OH, USA), and stained with ethidium bromide.

A Gene Ruler(TM) 100 bp DNA Ladder Plus (MBI Fermentas, Vilnius, Lithuania) was used as the molecular weight marker. Image acquisition was performed using UVITEC (Eppendorf).

3. Results

DNA was successfully extracted from all 80 samples of processed-meat products. All of these extractions resulted in PCR products clearly visible as single bands of expected size (227 bp chicken, 398 bp pork, 274 bp bovine) on agarose gel. All positive and negative controls, which were run alongside each separate PCR, gave the expected results. The analytical sensitivity or limit of detection (LoD) of the PCR assay, defined as the lowest DNA concentration that produced amplification, corresponded to 1%.

The results, reported in Table 2, revealed a high species substitution rate among the meat products, highlighting 43/80 (54%) mislabeling cases. In particular, 24/43 chicken sausage samples resulted porkand bovine-positive, 12/43chicken sausage samples resulted onlypork-positive while 7/43 bovinepositive. The presence of bovine DNA, probably due to the addition of non-fat dry milk powder in order to increase the overall yield and to improve its binding qualities, was exclusively indicated on 9/80 labels of chicken sausages

4. Discussion

The global incidence of food misdescription and adulteration is increasing, and the international food trade is frequently disrupted by disputes over food safety and quality requirements [10]. The recent controversies surrounding the horse meat scandal have forced the authorities to enforce stringent regulations on food adulterations [21].

Our study reveals a high probability of incorrect species declaration in chicken meatproducts and insufficient labeling information. Thus this study confirms that such fraudulent misdescriptions, with various undeclared species in ready-to-cook meat products, and adulteration of meat products with an unindicated mixture of meats, are widespread problems [9, 5,10].

The presence of different animal species in these products could be due to the fact that meat from different animal species is processed in the same meat plants and the presence may be caused by the unintentional and incidental commingling of trace amounts of one type of meat or meat products with another during processing and handling. Whether deliberate or unintentional, moreover, the effects of meat product misdescription are similar, and include consumer deception, potential health risks and the inability of individuals to choose products on the basis of their religious and ethical beliefs. In particular, scientific evidence against fraud is important in Halal authentication. Meat which is Halal is the major concern of Muslim consumers: permitted animal and bird meats according to Islamic law are considered Halal. The lack of a correct labeling, in this case, is cause to violation of their religious beliefs.

Therefore, whether deliberate or unintentional, the presence of different animal species where the meat constitutes an ingredient of another food must be indicated as "... meat' preceded by the name(s) of the animal species from which it comes" in accordance with Reg. CE 1169/11 (Annex VII, Part B, comma 17)[13]. Labeling is the primary means of communication between producers and consumers.Although labeling policies differ widely in character, material facts and allergen information are expected to be part of standard labeling practice [21].

Given that the authentication of species in meat products is crucial to protect the consumer and has various implications [23] regular monitoring to counteract fraud is a requirement if the authorities are to ensure safe, unadulterated and quality food.

This study, therefore, demonstrates the need to adopt and carry out stringent control measures, as well as to assess compliance with labeling requirements. European regulations on the traceability and labeling of food products require the food chain to be traceable, so as to inform consumers via compulsory product labeling and in order to create a safety net based on the traceability at all stages of production and distribution to the marketplace.

Considering the high prevalence of meat fraud and mislabeling in meat and meat products, robust analytical tests are required to ensure adherence to regulations and to enforce punitive measures [5].Progress in the area of authentication of traded food products requires the use of molecular tools to ensure proper species identification, thus enhancing the application of effective food control regulations and consumer protection [17].A great effort should therefore be made to create a strong and standardized monitoring program or strategy, and finally, to evoke consumer awareness on several aspects relating to accurate labeling information.

5. Conclusions

Considering the widespread distribution of fraudulent misdescription of food contents [9, 2, 8, 7], intensive and continuous monitoring is strongly recommended in order to ensure that consumers can make conscious choices. Therefore, the food control authorities may upgrade their systems to identify food sources and monitor quality to ensure that proper processing has taken place and labeling information reflects actual contents. Moreover, authentication of species in meat products usually involves testing procedures to confirm the species reported on the label and the presence of other suspected species. In addition, adventitious traces of meat have become a major concern for regulators when formulating significant legislation. Any adventitious or low-level presence linked to the unintentional and incidental presence of trace amounts of one type of meat or meat products with another during processing and handling may be regulated and controlled by the authorities with frequent monitoring procedures at all levels starting from primary production and processors all the way to the end of the supply chain [21].

Enforcing European legislation guidelines would be associated with the development and application of reliable labeling implementation plans and appropriate traceability systems in order to guarantee an efficient food safety system. In summary, a continuous monitoring scheme along with improved detection methodologies and stringent sanctions on defaulters may help to minimize authentication problems in future.

References

6. References

1. Aida A A, Man Y B C, Wong C M V L, Raha A R, & Son R: Analysis of raw meats and fats of pigs using polymerase chain reaction for Halal authentication. Meat Science 2005, 69, 47-52.

2. Aida A A, Che Man, Y B, Raha A R, & Son R: Detection of pig derivatives in food products for halal authentication by polymerase chain reaction restriction fragment length poly morphism Jowr^J of the Science of Food and Agriculture 2007, 87, 569-572.

3. Ali ME, Hashim U, Mustafa S, Che Man YB, Dhahi Th S, Kashif M:Analysis of pork adulteration in commercial meatballs targeting porcine-specific mitochondrial cytochrome b gene by TaqMan probe real-time polymerase chain reaction .Meat Science 2012, 91,454-A59.

4. Ballin N Z, Vogens en F K & Karlsson A H: Species determination - Can we detect and quantify meat adulteration? Meat Science 2009, 83, 165-174.

5. Ballin N Z: Authentication of meat and meat products.Mafr Science 2010, 86, 577-587.

6. Böhler E, Schäfer T, Ruhdorfer S, Weigl L, Wessner D, Heinrich J, Filipiak B, Wichmann H E, Ring J: Epidemiology of food allergy in adults. Allergo J2001,10:318-9.

7. Cawthom DM, Steinman HA, & Hoffman LC: A high incidence of species substitution and mislabelling detected in meat products sold in South Africa. Food Control. 2013, 32, 440-449.

8. Chen SY, Liu YP & Yao YG: Species authentication of commercial beef jerky based on PCR-RFLP analysis of the mitochondrial 12S rRNA gene. Journal of Genetics and Genomics. 2010, 37, 763-769.

9. Di Pinto A, Forte VT, Conversano MC &Tantillo G: Duplex polymerase chain reaction (D-PCR) for detection of pork meat in horse meat fresh sausages from Italian retail sources. Food Control 2005, 16, 391-394.

10. Di Pinto A, Di Pinto P, Terio V, Bozzo G, Bonerba E, Ceci E & Tantillo G: DNA barcoding for detecting market substitution in salted cod fillets and battered cod chunks. Food Chemistry 2013,141, 1757-1762.

11. Directive 2000/13/EC of the European Parliament and of the Council of 20 March 2000 on the approximation of the laws of the Member States relating to the labelling, presentation and advertising of foodstuffs.

12. EFSA (European Food Safety Authority): Scientific Opinion on the public health risks related to mechanically separated meat (MSM) derived from poultry and swine. EFSA Journal 2013,11(3):3137.

13. European Commission Regulation (EU) No 1169/2011 of the European Parliament and of the Council of 25 October 2011 on the provision of food information to consumers, amending Regulations (EC) No 1924/2006 and (EC) No 1925/2006 of the European Parliament and of the Council, and repealing Commission Directive 87/250/EEC, Council Directive 90/496/ EEC, Commission Directive 1999/ 10/EC, Directive 2000/13/EC of the European Parliament and of the Council, Commission Directives 2002/67/EC and 2008/5/EC and Commission Regulation (EC) No 608/2004.

14. Fajardo V, Gonzalez I, Rojas M, García T & Martin R:A review of current PCR-based methodologies for the authentication of meats from game animal species. Trends in Food Science and Technology 2010, 21, 408^121.

15. Llatser R, Polo F, De La Hoz F, Guillaumet B: Alimentary allergy to pork. Cross reactivity among pork kidney and pork and lamb gut. ClinExp Allergy 1998, 28, 1021-5.

16. Mafra I, Ferreira I. M. P. L. V. O & Oliveira M. B. P. P.: Food authentication by PCR-based methods. European Food Research and Technology 2008, 227, 649-665.

17. Marin A, Fujimoto T, Arai K: Rapid species identification of fresh and processed scallops by multiplex PCR. Food Control 2013, 32, 472476.

18. Matsunaga T, Chikuni K, Tanabe R,Muroya S, Shibata K, Yamada J: A quick and simple method for the identification of meat species and meat products by PCR assay. Meat Science 1999, 51, 143-148.

19. Nakyinsige K, Che Man Y B &Sazili A Q: Halal authenticity issues in meat and meat products. Meat Science 2012, 91, 207-214.

20. Ortea I, Pascoal A, Cañas B, Gallardo JM, Velazquez J B & Calo-Mata P: Food authentication of commercially relevant shrimp and prawn species: From classical methods to Foodomics. Electrophoresis 2012, 33, 2201-2211.

21. Premanandh J: Horse meat scandal-A wake-up call for regulatory authorities. Food Control 2013,34, 568-569.

22. Singh V P & Neelam S: Meat species specifications to ensure the quality of meat: a review. International Journal of Meat Science 2011,1, 15-26.

23. Soares S, Amaral J S, Oliveira M B P P & Mafra I: A SYBR Green real-time PCR assay to detect and quantify pork meat in processed poultry meat products. Meat Science 2013, 94, 115-120.

24. Spink J & Moyer D C:Defining the public health threat of food fraud. Journal of Food Science 2011,76, 157-163.

25. Tanabe S, Miyauchi E, Muneshige A, Mio K, Sato C & Sato: M PCR method of detecting pork in foods for verifying allergen labeling and for identifying hidden pork ingredients in processed foods. Bioscience, Biotechnology, and Biochemistry 2007, 71, 1663-1667.