Exploring the Role of a Novel Interleukin-17 Homolog from Invertebrate Marine Mussel Mytilus coruscus in Innate Immune Response: Is Negative Regulation by Mc-Novel_miR_145 the Key?

Abstract

Interleukin-17 (IL-17) represents a class of proinflammatory cytokines involved in chronic inflammatory and degenerative disorders. Prior to this study, it was predicted that an IL-17 homolog could be targeted by Mc-novel_miR_145 to participate in the immune response of Mytilus coruscus. This study employed a variety of molecular and cell biology research methods to explore the association between Mc-novel_miR_145 and IL-17 homolog and their immunomodulatory effects. The bioinformatics prediction confirmed the affiliation of the IL-17 homolog with the mussel IL-17 family, followed by quantitative real-time PCR assays (qPCR) to demonstrate that McIL-17-3 was highly expressed in immune-associated tissues and responded to bacterial challenges. Results from luciferase reporter assays confirmed the potential of McIL-17-3 to activate downstream NF-κb and its targeting by Mc-novel_miR_145 in HEK293 cells. The study also produced McIL-17-3 antiserum and found that Mc-novel_miR_145 negatively regulates McIL-17-3 via western blotting and qPCR assays. Furthermore, flow cytometry analysis indicated that Mc-novel_miR_145 negatively regulated McIL-17-3 to alleviate LPS-induced apoptosis. Collectively, the current results showed that McIL-17-3 played an important role in molluscan immune defense against bacterial attack. Furthermore, McIL-17-3 was negatively regulated by Mc-novel_miR_145 to participate in LPS-induced apoptosis. Our findings provide new insights into noncoding RNA regulation in invertebrate models.

1. Introduction

The immune system plays a crucial role in the organism’s defense against the invasion of exogenous pathogens. Conventionally, the defense system is divided into innate immunity and acquired immunity. Innate immunity represents the body’s first line of defense against pathogens, which can detect pathogen invasion and partially eliminate them [1]. Innate immunity is mediated by a great variety of cells, including natural killer cells, monocytes, neutrophils, eosinophils, basophils, and circulating dendritic cells, which are collectively known as innate immune cells. These cells release a large number of cytokines that are involved in cellular communication and thereby help coordinate immune responses [2]. In the case of infection and inflammation, cytokines function as modulators: some cytokines make disease worse (proinflammatory), while others promote health (anti-inflammatory) [3]. Cytokines are subject to high levels of evolutionary pressure and thus exhibit sequence diversification [4], whereas the IL-17 cytokine family shows high conservation, which is manifested by a cysteine-knot fold in the functional architecture formed through interactions among four conserved cysteine residues [5]. Recent studies have demonstrated that IL-17 is a class of proinflammatory cytokines involved in chronic inflammatory and degenerative disorders [6]. The IL-17s function by binding specifically to receptors to promote inflammation development, immune rejection, and hematopoiesis. The IL-17 family of cytokines in humans consists of six members (IL-17A to IL-17F), which are produced by activated T lymphocytes and other innate cell populations in response to IL-1β and IL-23 [7,8]. However, a growing body of evidence suggests that the IL-17 family experienced a marked expansion in marine molluscs and echinoderm species. In the genome of the purple sea urchin Strongylocentrotus purpuratus, about 30 IL-17 genes were detected [9]. Similarly, 31 octopus IL-17-like genes were found in Coleoid cephalopods, wherein 27 genes have a mighty expression in the suckers and skin [10]. Saco, et al. [11] retrieved 379 unique IL-17 sequences from 15 resequenced mussel genomes and the M. galloprovincialis reference genome [12] and divided them into 23 isoforms through phylogenetic analysis. Further, they found that IL-17 isoforms from Mytilidae species were conserved among individuals and shared between closely related species. In addition to Mytilidae species, the large IL-17 families were also found in other molluscs species, including Crassostrea gigas, Mizuhopecten yessoensis, and Pinctada fucata martensii [13]. Seawater is teeming with pathogens, and marine molluscs are in constant contact with them, and therefore a powerful arsenal of immune molecules is needed, thereupon the expansion of the IL-17 family endows these animals with more effective immune responses.

There have been several studies indicating the significant role that IL-17s play in the innate immunity of molluscan animals. For example, research has found that upon infection by Vibrio harveyi, the mRNA level of IL-17D was greatly up-regulated in Tegillarca granosa [14], while in C. gigas, CgIL17-5 showed a distinct reaction to Vibrio splendidus [15]. Additionally, molluscan IL-17s have been shown to respond to many pathogen-associated molecular patterns (PAMPs), such as lipopolysaccharide (LPS), polyinosinic:polycytidylic acid (polyI:C), and peptidoglycan (PGN). LPS is a major component of the outer wall of Gram-negative bacterial cell walls and represents one of the most commonly used immune stimulants. On the other hand, polyI:C is a double-stranded RNA analog that is frequently used as a virus simulator in scientific research. After the stimulation by LPS, the transcriptional expression of IL-17 family genes was quickly triggered in the Pacific oyster C. gigas and pearl oyster P. fucata [16,17]. Also in pearl oyster, PfIL-17 was found to be involved in the immune response to polyI:C stimulation [17]. In addition, a dual luciferase assay showed that PfIL-17 was able to activate vertebrate target genes containing NF-kB binding sites and participate in the NF-kB signaling pathway in HEK293 cells [17]. PGN is present in the cell wall of Gram-positive bacteria and is often used as a mimic for Gram-positive bacteria. The recombinant C. gigas IL17-5 was proved to have a strong affinity to PGN, which had never been reported in vertebrate interleukins [18]. These studies provided a prelude to revealing the IL-17 immunomodulatory function in molluscs.

As a class of pro-inflammatory cytokines, the excessive expression of IL-17 can induce serious damage to cells. The organisms have developed various mechanisms to control the overreaction of IL-17, of which microRNAs (miRNAs) represent the most potent and well-studied class of non-coding RNAs. MiRNAs are a family of short RNAs about 22 nt in length that can regulate the expression of target genes by translational repression or mRNA degradation [19]. The current research on the regulation of IL-17s by miRNAs mainly focuses on their synergic effects in human autoimmune diseases such as multiple sclerosis, rheumatoid arthritis, psoriasis, and among others [20]. The technique development of high-throughput sequencing and biological calculation makes it possible to scan molluscan miRNAs at the genomic level, and a large number of conserved and novel miRNAs have been identified from mollusc species such as flat oyster Ostrea edulis, Pacific oyster C. gigas, Lymnaea stagnalis, mussel M. galloprovincialis, etc. [21,22,23,24,25,26,27,28,29]. These studies provide basic data and great support for the functional interpretation of miRNAs in molluscs. Concerning the immunoregulatory role of certain miRNAs in molluscs, Tian, et al. [30] found that Pm-miR-29a could positively regulate IL-17 in Pinctada martensii; after the overexpression of Pm-miR-29a, the expression of IL-17 in the mantle and gill of the species was up-regulated. In C. gigas, cgi-miR-2d augmented oyster hemocyte phagocytosis by negatively regulating CgIκB2 [31] and negatively regulating the expression of a choline transporter-like gene in the early stage of infection, which was involved in sophisticated immunomodulation [32]. During desiccation, cgi-miR-365 was found to be induced by norepinephrine and directly promoted CgHSP90AA1 expression [33]. Recent studies showed that miRNA scaffold659_26519 targets calmodulin to regulate IL-17 expression in the early phase of the immune response of C. gigas [34]. In addition, specific functions of certain miRNAs have been described in other invertebrates, such as sea cucumber Apostichopus japonicus [35,36,37,38,39] and prawn Litopenaeus vannamei [40]. These studies have opened the veil to the underlying mechanisms of miRNAs in invertebrates and also provided technical and methodological references for our current research.

In our previous study, 26 miRNAs and 667 genes of M. coruscus were biologically calculated for differential expression after Vibrio alginolyticus challenge, of which Mc-novel_miR_145 can target an IL-17 homolog and be involved in the immune response to bacterial infection [41]. The objective of the present study is to identify the IL-17 gene and investigate its potential role in innate immunity and its regulation by the miRNA Mc-novel_miR_145 in M. coruscus. Through this study, we aim to gain a better understanding of the immune response mechanisms of molluscs and shed light on the molecular basis of their immune defense against pathogens. This research can also provide insights into noncoding RNA regulation in invertebrate models.

2. Results

2.1. Characterization of McIL-17-3

The McIL-17-3 cDNA sequence containing the complete ORF, 3′-UTR, and partial 5′-UTR was in silico cloned from the M. coruscus full-length transcriptome (accession number: PRJNA798880, F01_transcript_12404). McIL-17-3 contains a 585 bp ORF region encoding 194 amino acids. The predicted molecular weight is 21.77 kDa, and the isoelectric point is 5.21. SMART analysis revealed a typical IL-17 domain in this protein (Figure 1A). A phylogenetic tree was constructed by recruiting IL-17 members of vertebrate and Mytilidae species, and IL2s were used as the outgroup. As shown in Figure 1B, these IL-17s gathered into a specific branch to distinguish them from IL-2s. Within the IL-17 cluster, two apparent clades were shown, one composed of vertebrate IL-17s and the other composed of mussel IL-17s. In the mussel IL-17 group, McIL-17-3 first clustered with the corresponding molecule from another Mytilus species, M. galloprovincialis (Figure 1B).

2.2. Multiple Alignment and Tertiary Structure Prediction

The core of the McIL-17-3 is composed of two pairs of antiparallel β-strands; one pair includes strands 1 (residues 52–58) and 2 (residues 66–72 and 77–79), while the other includes strands 3 (residues 89–103) and 4 (residues 110–125) (Figure 2B,C). Two disulfide bridges (Cys97/Cys134 and Cys125/Cys169) connect strands 1 and 3, 2 and 4, respectively (Figure 2A,C). Consistently, other molluscan IL-17s also possess these two disulfide bridges between strands 1 and 3, 2 and 4 (Figure 2A,C). Notably, although vertebrate IL-17s also have two disulfide bridges, they exist between 2 and 4 (Figure 2A,C).

2.3. Transcriptional Expression of McIL-17-3

The profile of tissue distribution of McIL-17-3 transcripts was assessed by qPCR. The transcripts of McIL-17-3 were expressed in all tested tissues, and expression levels in hemocytes and gills were significantly higher than those in adductor muscle (Figure 3A). Temporal expression of hemocyte McIL-17-3 transcripts in response to V. alginolyticus challenge was also assessed. The mRNA level of McIL-17-3 was significantly up-regulated at 3 and 12 hpc (3.13- or 4.35-fold increase compared to 0 hpc, respectively), but there was no obvious temporal regularity in general (Figure 3B).

2.4. The Activation of Downstream by McIL-17-3

As shown in Figure 4, recombinant McIL-17-3 increased the luciferase activity of pGLNF-κB-luc in a dose-dependent manner. At 0.5 and 1.0 µg/well, the luciferase activity of pGLNF-κB-luc increased 2.07- and 11.07-fold, respectively.

2.5. Confirmation of McIL-17-3 as a Target Gene of Mc-novel_miR_145

Through bioinformatics prediction, the McIL-17-3 gene contains a standard target sequence for Mc-novel_miR_145 at its 3′UTR (Figure 5A). Mc-novel_miR_145 mimic and inhibitor were co-transfected with the wild-type McIL-17-3-3′UTR reporter plasmid into HEK293 cells to confirm their correlation. As shown in Figure 5B, Mc-novel_miR_145 mimic can obviously inhibit the luciferase activity of McIL-17-3-3′UTR-WT (0.67-fold decrease compared to control), while Mc-novel_miR_145 inhibitor remarkably alleviates the effects (1.64-fold increase compared to Mc-novel_miR_145 mimic as a merely added group). To assess whether Mc-novel_miR_145 directly targets the McIL-17-3 gene through the target site in the 3′UTR, we constructed the mutant version of luciferase reporter plasmids that mutated the Mc-novel_miR_145 targeting sequences in the McIL-17-3 3′UTR. As shown in Figure 5C, Mc-novel_miR_145 mimic significantly decreased the luciferase activity of the cells transfected with the McIL-17-3-3′UTR-WT (0.27-fold decrease), while no change in luciferase activity was observed in cells transfected with the McIL-17-3-3′ UTR-MUT. Additionally, the dose-dependent effects of the Mc-novel_miR_145 mimic on the inhibition of McIL-17-3-3′UTR-WT luciferase activity could also be observed at 24 h post-transfection (0.71-, 0.43-, and 0.20-fold decrease compared to control, respectively, Figure 5D).

2.6. Mc-novel_miR_145 Negatively Regulates the Expression of McIL-17-3

The M. coruscus hemocytes were transfected with Mc-novel_miR_145 mimic, Mc-novel_miR_145 inhibitor, and their respective controls, and the changes in McIL-17-3 expression were assessed on the transcriptional and protein levels. As shown in Figure 6A, the expression of Mc-novel_miR_145 was significantly up-regulated (8.83-fold increase) by its mimic and down-regulated (0.41-fold decrease) by its repressor in hemocytes, suggesting effective effects of these synthetic compound substances. In Figure 6B, the expression of endogenous McIL-17-3 was significantly inhibited (0.51-fold decrease) by Mc-novel_miR_145 mimic at the transcriptional level and significantly induced (2.42-fold increase) by Mc-novel_miR_145 inhibitor. To investigate the effects of Mc-novel_miR_145 on the expression of McIL-17-3 at the protein level, a polyclonal antibody against McIL-17-3 was produced. As shown in lanes 2 and 3 in Figure 6C, the recombinant McIL-17-3 protein was successfully expressed in E. coli. The antibody specificity was examined with the mussel protein from hemocytes by Western blot. A single band of about 22 kDa, corresponding to the molecular mass of McIL-17-3, was observed (lane 4 in Figure 6C). The results of the Western blot in Figure 6D showed the negative regulation of McIL-17-3 at the protein level by Mc-novel_miR_145.

2.7. Apoptosis of Hemocytes

The hemocyte apoptotic rate of four groups, i.e., NC+LPS, McIL-17-3+LPS, Mc-novel_miR_145+McIL-17-3+LPS, and Mc-novel_miR_145-i+McIL-17-3+LPS was analyzed by flow cytometry using double staining. After McIL-17-3 was overexpressed, the apoptosis rate of hemocytes challenged with LPS was significantly up-regulated compared to the control group (Figure 7A(a,b),B). When McIL-17-3 was cotransfected with Mc-novel_miR_145, the hemocyte apoptosis rate induced by LPS significantly decreased compared with that of McIL-17-3 transfected alone (Figure 7A(b,c),B). In contrast, the hemocyte apoptotic rate showed a remarkable increase in the Mc-novel_miR_145-i+ McIL-17-3+LPS group compared to the McIL-17-3+LPS group (Figure 7A(b,d),B).

3. Discussion

IL-17 is recognized to be one of the important pro-inflammatory cytokine families, which can effectively participate in the pathogenesis of different diseases [42]. In our previous study, an M. coruscus IL-17 homolog showed differential expression before and after V. alginolyticus infection through transcriptome sequencing [41], suggesting its potential role in the innate immune response to bacterial challenge. Here, we characterized this IL-17 homolog and named it McIL-17-3. The functional domain prediction revealed a typical IL-17 domain, endowing the currently identified gene affiliation to the IL-17 cytokine family. In the phylogenetic tree, this novel IL-17 gene showed a very close kinship with IL-17-3 from another Mytilus species, M. galloprovincialis. Additionally, they shared a very high 95% amino acid identity, and therefore we nominated the current novel IL-17 gene as McIL-17-3 to follow the naming convention used in Mytilus species. The IL-17 family consists of six members and five receptors in humans [43], but it has experienced a huge genetic expansion in marine invertebrates, especially in mussels [11]. Based on this, our data suggested that McIL-17-3 was not directly related to certain genes in the human IL-17 family. The cysteine-knot fold located at β-sheets is the typical characteristic of the IL-17 family [5]. Expectedly, the prediction of tertiary structure revealed a cysteine-knot fold in the McIL-17-3 protein, further deepening the attribution of McIL-17-3 to the IL-17 cytokine family. To further explore the differentiation of IL-17 amino acid sequences among different species, some typical mussel IL-17s and Mus musculus IL-17-A to IL-17-F and Danio rerio IL-17-1 to IL-17-3 were selected to perform the multiple alignment analysis. The results showed an interesting finding that the disulfide linkage position of IL-17s in mussels and vertebrates was inconsistent: these two disulfide linkages existed between β-strands 1 and 3, 2 and 4, respectively, in mussels, but only between β-strands 2 and 4 in vertebrates. At the first and fourth cysteine sites, vertebrate IL-17s replace cysteine with serine; contrastingly, at the second cysteine site, mussel IL-17s replace cysteine with threonine; and at the sixth site, with glutamine, arginine, and valine. This is the first time to report the IL-17s differentiation at disulfide linkage in mussels and vertebrates, and its underlying mechanism is unclear and needs further study. Given the polymorphism of IL-17s in mussels, the disulfide linkage between β-strands 1 and 3 may not be as strong as that between 2 and 4, conferring them greater plasticity in mussels. Anyway, analysis of functional domains and tertiary structure suggests that the McIL-17-3 currently identified is typical of the mussel IL-17 cytokine and might play a similar functional role to its counterparts in molluscs.

The expression of IL-17 genes in human tissues varies widely, with some being expressed in only a few cells and others in a large number of tissues [44,45]. Most of the studies on molluscs showed that IL-17s had a constitutive expression profile [13,15,17,46,47]. Nevertheless, Li, Zhang, Zhang, Xiang, Tong, Qu and Yu [47] showed an inconsistent result in C. gigas IL-17s: CgIL-17-2, -3, -4, and -6 were highly expressed in C. gigas gills, digestive glands, and mantle, but hardly expressed in other tissues. Here, McIL-17-3 transcripts were found in all tissues examined, suggesting its multiple functional roles in a variety of physiological activities. However, the high expression levels of McIL-17-3 in some molluscan immune-related tissues, such as hemocytes, gills, and digestive glands, suggest its closer involvement with immune response. Following, its rapid responsiveness to V. alginolyticus attack deepens this point. The injection of V. alginolyticus significantly up-regulated the expression of McIL-17-3, and similar results have also been observed in other molluscan IL-17s. Injection of V. anguillarum into C. gigas induced a fast increase in CgIL-17 transcript abundance in hemocytes, suggesting that it was an immune early phase gene [46]. When C. gigas suffered an attack by another pathogen, V. splendidus, the mRNA level of CgIL-17-5 in hemocytes was also significantly elevated [15]. The stimulation of LPS, the major pathogenic component of bacteria, dramatically increased the expression of PfIL-17 in the digestive glands of the pearl oyster P. fucata [17]. In addition, LPS could induce the expression of CgIL-17-3 in C. gigas [47] and PmIL-17-2 in P. fucata martensii [13]. These results collectively indicated that IL-17 played an important role in molluscan immune defense against bacterial attack. In this study, McIL-17-3 showed the activation capacity of the downstream NF-κB pathway. Similar results were also observed in some mollusc species. In the pearl oyster P. fucata, PfIL-17 also exhibited activation of the NF-κB pathway in HEK293 cells by the luciferase reporter assays [17]. In C. gigas, CgIL-17-5 promoted the activation of CgMAPKs and the nuclear translocation of CgRel and CgAP-1 to promote the mRNA expression of cytokines and antibacterial peptides [15]. It has been demonstrated that the mode of action of IL-17 is based on its union into dimers (homodimers or heterodimers), whose activity is highly dependent on their attachment to the receptors (IL-17Rs) they target. These receptors contain a conserved cytoplasmic domain (SEFIR) that interacts with adaptor proteins to initiate downstream signal transduction pathways for activating transcription factors such as NF-κB and promoting the expression of immune and pro-inflammatory target genes, such as cytokines and antimicrobial peptides [11,48,49]. These results suggest that molluscan IL-17s may have the same mode of action as their counterparts in vertebrates. This needs to be confirmed in future studies.

The correlations between miRNAs and IL-17s have been found in several human disease models. Niimoto, et al. [50] confirmed the positive correlation between miR-146a and IL-17a expression in peripheral blood mononuclear cells and synovium from rheumatoid arthritis patients and summarized the vital function of miR-146a in the differentiation of IL-17 producing cells. In psoriasis patients, miR-146a acts as a potent inhibitor of IL-17-driven skin inflammation, and its low levels may contribute to early disease onset in genetically susceptible individuals [51]. MiR-146a may ameliorate periodontitis by down-regulating the expression of IL-17 and inhibiting the proliferation of human periodontal ligament stem cells [52]. MiR-155 negatively regulates the expression of IL-17 to participate in the host immune response to postviral bacterial pneumonia in mice lung; miR-155 inhibited mice show stronger expression of IL-17 in the lung, accompanied by improved bacterial clearance [53]. These studies suggest that IL-17 is regulated by multiple miRNAs and varies with disease and cell type [20]. In a previous study, we performed an integrated analysis of the miRNAome and transcriptome to explore the interactive regulation of miRNA-mRNA by M. coruscus in response to V. alginolyticus infection. The results predicted that Mc-novel_miR_145 could target McIL-17-3 to participate in the innate immune response to bacterial infection [41]. Aiming to explore the underlying mechanism of Mc-novel_miR_145 regulation of McIL-17-3 in depth, a series of laboratory experiments were conducted in the present studies. The calculation means predicted that Mc-novel_miR_145 could target the 3′UTR of McIL-17-3. The following luciferase reporter assays performed in HEK293 cells co-transfected by Mc-novel_miR_145 mimic, mimic NC, inhibitor, inhibitor NC with McIL-17-3-3′UTR-WT, -MUT reporter plasmids further confirmed this point. Further, Mc-novel_miR_145 mimic, mimic NC, inhibitor, and inhibitor NC were transfected into M. coruscus hemocytes to evaluate their effects on McIL-17-3 expression at transcriptional and protein levels. The expression of McIL-17-3 was significantly down-regulated in the Mc-novel_miR_145 mimic transfection group, while significantly up-regulated in the Mc-novel_miR_145 inhibitor transfection group, suggesting a negative regulation of McIL-17-3 by Mc-novel_miR_145. The current results were contrary to a previous study. In Pinctada martensii, Tian, Zheng, Huang, Jiao and Du [30] found that although Pm-miR-29a could target IL-17, the regulation was positive, as the expression of IL-17 in the mantle and gill of Pinctada martensii was up-regulated after the overexpression of Pm-miR-29a. Given that P. martensii and M. coruscus both belong to bivalves and are relatively closely related, these inconsistent results suggest that the regulation of IL-17s in molluscs may vary with miRNAs. Other than this, no literature has reported the correlation between miRNAs and IL-17s in molluscs, and therefore there are no more parallel studies to compare the current results. However, a few studies have reported targeting relationships between specific miRNAs and specific immune-related genes in molluscs. For instance, cgi-miR-2d augments oyster hemocyte phagocytosis by negatively regulating CgIκB2 in Crassostrea gigas [31]. Additionally, cgi-miR-2d also negatively regulates the expression of one choline transporter-like gene to participate in the sophisticated immunomodulation of oyster hemocytes during the early stage of infection [32]. These studies at least suggest that miRNAs play a potential role in innate immune signaling by targeting specific genes in molluscs, just as they do in vertebrates.

Next, we sought to explore the potential function of the interaction between Mc-novel_miR_145 and McIL-17-3 in the innate immunity of M. coruscus, and their role in LPS-induced apoptosis is the focus of our attention. LPS is a highly proinflammatory molecule that is a component of the outer envelope of all Gram-negative bacteria. LPS has been shown to induce apoptosis in various cells and tissues, such as macrophages [54], endothelial cells [55], and mouse lung [56]. A preliminary experiment has demonstrated that LPS exposure at a nominal concentration of 0.1 mg/mL for 24 h significantly induced apoptosis of hemocytes from M. coruscus. After McIL-17-3 overexpression, the apoptosis level of M. coruscus hemocytes was significantly increased compared with the control group, suggesting that McIL-17-3 may strengthen LPS-induced apoptosis of hemocytes in M. coruscus. The current results were consistent with some previous studies. In human neutrophils, IL-17A could lessen the anti-apoptotic effects mediated by granulocyte macrophage-colony stimulating factor [57]. IL-17 induces apoptosis of vascular endothelial cells, which is a potential mechanism of acute coronary syndrome [58]. Genetic deletion of IL-17A reduces alveolar type II cell apoptosis and thus alleviates chronic obstructive pulmonary disease [59]. However, there are still some contrary arguments. When mice are infected by Theiler’s murine encephalomyelitis virus, IL-6 and IL-17 synergistically promote viral persistence by inhibiting cellular apoptosis [60]. These conflicts suggest that the underlying mechanism of IL-17-mediated apoptosis is complex, and IL-17s may play opposite functions depending on the type of infection.

When McIL-17-3 were co-transfected with Mc-novel_miR_145, the level of apoptosis induced by LPS was significantly down-regulated compared to the only McIL-17-3 transfected group, correspondingly, the apoptosis level was significantly up-regulated after McIL-17-3 was co-transfected with Mc-novel_miR_145 inhibitor. Mc-novel_miR_145 has been shown to negatively regulate McIL-17-3, and therefore we concluded that McIL-17-3 aggravated the hemocyte apoptosis induced by LPS, while Mc-novel_miR_145 alleviated the effects. Several miRNAs that have been shown to be involved in human and mouse cell apoptosis were identified in molluscs in the last few years. For instance, miR-125b and miR-335 were found in flat oyster Ostrea edulis [21], miR-184 was found in hemocytes of oyster Crassostrea gigas [23], and miR-9, -29, -96, -182, and -193 were found in the regenerating central nervous system of the L. stagnalis [25]. These apoptosis-related miRNAs identified through high-throughput sequencing and biology calculations confirm the existence of miRNA-mediated apoptosis in molluscs. Chen et al. reported an up-regulation of miR-2d after Vibrio splendidus challenge in the hemocytes of Crassostrea gigas. The overexpression of miR-2d was correlated with a knocking-down expression of IκB2, and a significant increase in hemocyte phagocytosis rate, linked with a suppression of apoptosis [31]. The results were consistent with our current study, collectively, seeming to imply that miRNAs exert an inhibitory function on cell apoptosis in molluscs. In fact, most of the apoptosis-related miRNAs in humans have shown inhibitory effects on apoptosis. MiR-146 protects A549 and H1975 cells from LPS-induced apoptosis and inflammation injury via up-regulating Sirt1 and thereby blocking NF-κB and Notch pathways [61]. Furthermore, miR-146 attenuates irradiation- and LPS-induced hepatocyte apoptosis through inhibition of the TLR4 pathway [62]. MiR-93 inhibits chondrocyte apoptosis in osteoarthritis by targeting the TLR4/NF-κB signaling pathway [63]. MiR-129-5p alleviates spinal cord injury in mice via suppressing apoptosis through the HMGB1/TLR4/NF-κB pathway [64]. However, there are still some specific miRNAs that show reinforcing actions on apoptosis. For instance, miR-203 was found to accelerate LPS-induced apoptosis by targeting PIK3CA in alveolar epithelial cells [65]. These results suggest the complexity of the underlying mechanism of miRNA-mediated apoptosis.

4. Materials and Methods

4.1. Experimental Design

Firstly, McIL-17-3 was identified and characterized from M. coruscus through bioinformatic analysis. Following this, the tissue distribution of McIL-17-3 transcripts as well as its response to bacterial challenge were assessed by quantitative real-time PCR (qPCR) assays. Next, the association between McIL-17-3 and Mc-novel_miR_145 was determined by luciferase reporter analysis performed in HEK293 cells and M. coruscus hemocytes. Additionally, their functional role in LPS-induced apoptosis was assessed by flow cytometry.

4.2. Artificial Seawater

After three days of aeration of municipal tap water, instant sea crystal (Haiding LTD, Ji’an, China) was added, thoroughly stirred, and melted to reach a salinity of 30‰. The configured artificial seawater needs to be aerated for 2 h before being used.

4.3. Animals

The thick-shelled mussel M. coruscus (shell length, 9.82 ± 0.53 cm; shell width, 4.68 ± 0.45 cm; wet weight, 71.2 ± 2.7 g) were purchased from Donghe market in Zhoushan, Zhejiang Province, China. All mussels were kept in tanks filled with an ASW of about 25 °C and salinity of 30‰ for more than a week before subsequent experiments.

4.4. McIL-17-3 cDNA Identification

An IL-17 homolog (McIL-17-3) was in silico cloned from the full-length transcriptome of M. coruscus (accession number: PRJNA798880, F01_transcript_12404). The Blast procedure was performed to predict the putative McIL-17-3 amino acid sequence, followed by functional domain analysis with SMART and phylogenetic relationship assessment with MEGA-X. The multiple alignment was performed using the ClustalW procedure. The Swiss model and pyMol were used to predict the tertiary structure of the McIL-17-3 protein. The detailed procedure was according to our previous study [66].

4.5. Quantitative Real-Time PCR Assays

Quantitative real-time PCR assays (qPCR) are a powerful tool for detecting and measuring gene expression levels. Here, the tissue distribution of McIL-17-3 was evaluated using the qPCR method. In addition, changes in the expression of McIL-17-3 mRNA in response to bacterial infection were also detected by qPCR. The tissue distribution profile of McIL-17-3 was determined in gills, mantle, digestive glands, gonad, adductor muscle, and hemocytes using qPCR programmed at 95 °C for 10 min, followed by 40 cycles of 95 °C for 10 s, 60 °C for 45 s. These tissues were dissected from nine mussel individuals and pooled together to alleviate individual differentiation.

In the bacterial challenge experiment, live V. alginolyticus were used as the immune stimuli. A volume of 100 μL of bacteria dissolved in seawater (1 × 10⁸ CFU mL⁻¹) was injected into the adductor of mussels. No injected mussels were used as the control. Nine mussels were randomly sampled from each group at 0, 3, 6, 12, 24, and 36 h post-challenge (hpc). The hemocytes from three mussels were pooled together to be deemed as one sample, and there were three samples for each time point. MicroRNAs were extracted using the miRNA Extraction Kit (HaiGENE, Cat. No.: B1802), and the cDNA was synthesized using the miRcute Plus miRNA First-Strand cDNA Kit (Tiangen, Cat. No.: 4992786) and qPCR was performed using the miRcute Plus miRNA qPCR Kit (Tiangen, Cat. No.: 4992887). U6 and β-actin genes were used as the internal references for qPCR and miRNAs qPCR, respectively. The specific primer pairs used in this experiment are listed in Table 1. The relative expression levels were measured using the 2^−ΔΔCt method [67].

4.6. Cell Culture

The mammalian HEK293 cells (RiboBio Ltd., Guangzhou, China) were employed to perform the luciferase reporter assays to determine the downstream activation by McIL-17-3 as well as the association between Mc-novel_miR_145 and McIL-17-3. HEK293 cells were cultured in OPTI-MEM medium (GIBCO) at 37 °C, 5% CO₂. To further explore the regulation of McIL-17-3 by Mc-novel_miR_145 and their functional role in LPS-induced apoptosis, hemocytes of M. coruscus were retrieved from the adductor muscle of each mussel with a 0.5 mm-diameter (25 G) disposable needle containing 0.5 mL of the anticoagulant. Hemocytes were collected by centrifugation for 5 min at 3000 rpm, 4 °C, and 0.25% trypsin (Solarbio) was added. Hemocytes were suspended in an L-15 medium containing 15% fetal bovine serum (Solarbio) and cultured at 26 °C with 5% CO₂.

4.7. Synthesis of miRNA Mimic and Inhibitor

The Mc-novel_miR_145 mimic, inhibitor, and control nucleotides were composed by GenePharma (Shanghai). Their sequence is as follows: Mc-novel_miR_145 mimic, 52032-UCCAGAAAAGCGCUUCGGACG-3′; Mc-novel_miR_145 inhibitor, 5′-CGUCCGAAGCGCUUUUCUGGA-3′ (chemically modified by 2′Ome); negative control mimic, 5′-UUGUACUACACAAAAGUACUG-3′; and negative control inhibitor, 5′-CAGUACUUUUGUGUAGUACAA-3′ (chemically modified by 2′Ome).

4.8. Luciferase Reporter Analysis

Luciferase reporter assays are widely used to study gene expression and regulatory activity. The amount of light generated is proportional to the amount of luciferase enzyme produced, which in turn reflects the activity of the regulatory element. The luciferase activity is then measured using a luminometer, and the results are analyzed and interpreted to determine the regulatory activity of the studied element. Luciferase reporter assays were employed to analyze the downstream activation of McIL-17-3. In this experiment, the pEGFP-McIL-17-3 plasmid (0.1, 0.5, and 1.0 µg/well) along with the pGLNF-κb-luc reporter plasmid (0.25 µg/well) were cotransfected into HEK293 cells using Lipo6000^TM for 24 h. A blank pEGFP-N1 plasmid was used as the control. Luciferase activity was measured using the Dual-Luciferase^® Reporter Assay System (Promega, Madison, WI, USA) according to the specification, with Renilla luciferase used as the inter control. Mc-novel_miR_145 targeting McIL-17-3 was also confirmed by luciferase reporter assays. The bioinformatic calculation predicted that Mc-novel_miR_145 can target the 3′-UTR of McIL-17-3, and subsequently cloned the 3′-UTR of McIL-17-3 into the pmiR-RB-Report^TM luciferase reporter vector to construct the wild McIL-17-3-3′UTR-WT reporter plasmid. The mutant-type McIL-17-3-3′UTR-MUT reporter vector was constructed by mutating the nucleotide at 1023–1040 sites: TCCGAAGCGCTTTTCTGG to AGGCTTCGCGAAAAGACC. RNA oligo (Mc-novel_miR_196 NC, mimic, NCi, inhibitor) was transfected along with McIL-17-3-3′UTR-WT or McIL-17-3-3′UTR-MUT into HEK293 cells using Lipo6000^TM.

4.9. Recombinant Expression, Purification and the Antiserum Preparation

To assess the effect of Mc-novel_miR_145 on the expression of the McIL-17-3 protein, an antiserum of McIL-17-3 was prepared. The cDNA fragment covering the open reading frame (ORF) of McIL-17-3 was amplified with one specific primer pair (Table 1) and inserted into the pET-32a vector. The recombinant plasmid pET-32a-McIL-17-3 was transformed into Escherichia coli (DE3) (Takara) and incubated in LB medium (containing 50 mg L⁻¹ kanamycin) at 37 °C with shaking at 130 rpm for 4 h. After the optical density reached absorbance 0.6 at 600 nm, the isopropyl-beta-D-thiogalactopy ranoside (IPTG) with a final concentration of 1 mM was added to the bacterial solution to induce the expression of recombinant McIL-17-3 protein (rMcIL-17-3). After incubation at 37 °C for 6 h, the medium was centrifuged at 8000 rpm for 30 min to collect the bacteria, followed by suspension in TBS buffer (20 mM Tris-HCl, 150 mM NaCl, pH 8.0). The rMcIL-17-3 was purified by Ni-nitorilotriacetic acid (NI-NTA) affinity chromatography, and the purified protein was dialyzed out of imidazole for 24 h. The resultant protein was isolated by reducing 12% SDS-polyacrylamide gel electrophoresis (SDS-PAGE). The purified protein was refolded in a gradient urea-TBS glycerol buffer (50 mM Tris-HCl, 50 mM NaCl, 2 mM reduced glutathione, 10% glycerol, 0.2 mM oxide glutathione, a gradient urea concentration of 6, 4, 3, 2, 1, and 0 M urea in each gradient, pH 7.4, each gradient at 4 °C for 12 h). Then, the resultant protein was used to immunize 6-week-old mice to acquire polyclonal antibodies.

4.10. Western Blotting

Protein samples were extracted from hemocytes with RIPA lysis buffer (Beyotime), and then the concentration was detected with a BCA kit. After isolation by SDS-PAGE, the protein was transferred to PVDF membranes with sealing by 5% skim milk powder in TBST (20 Mm Tris-HCl, 150 mM NaCl, 1% Tween-20, pH 8.0), followed by the antibody against McIL-17-3 incubation overnight. Subsequently, the membranes were incubated with a diluted solution of goat anti-mouse IgG antibody and alkaline phosphatase conjugate (Thermo Fisher Scientific, Cat. No.: 31324) in the secondary antibody dilution buffer (Beyotime, P0258) for 3 h. Finally, the immunoreactive proteins were detected by the ECL detection system.

4.11. Apoptosis

Hemocyte apoptosis was assessed using flow cytometry according to the manual of the FITC-Annexin-V Apoptosis Detection Kit (Beyotime). Briefly, the collected hemocytes were treated for 24 h with LPS (0.1 mg/mL), 20 nM of pEGFP-McIL-17-3 plasmid, Mc-novel_miR_145 mimic, and Mc-novel_miR_145 inhibitor. After washing with PBS, the cells were re-suspended in the L15 medium at a final concentration of 1 × 10⁶ cells mL⁻¹ and were stained with FITC-Annexin-V and PI by being incubated at room temperature for 25 min in the dark. Finally, the flow cytometry instrument (Beckman CytoFLEX FCM) was employed to detect cell apoptosis, and data were analyzed using FlowJo^TM 10 software.

4.12. Statistical Analysis

Experimental results were presented as the mean ± standard deviation (S.D.). The results were processed using a two-way ANOVA analysis of variance with Tukey’s multiple comparisons test, and the Origin2021 software was employed to analyze the data and construct figures.

5. Conclusions

In this study, a novel IL-17 homolog, McIL-17-3, was identified from M. coruscus and found to play a crucial role in molluscan immune defense against bacterial attack. Moreover, it was discovered that McIL-17-3 is negatively regulated by Mc-novel_miR_145, which contributes to its participation in LPS-induced apoptosis. The results of this study provide valuable insights into the regulatory role of IL-17 in the immune response of mussels and highlight the potential of noncoding RNA in regulating invertebrate immune defense mechanisms. However, it is important to note that some limitations exist in this study. Specifically, the mechanism underlying the action mode of McIL-17-3 was not studied and requires further investigation. Additionally, this study only focused on the interaction between Mc-novel_miR_145 and McIL-17-3 and did not explore the possible involvement of other miRNAs in the immune response. Overall, this study emphasizes the important role of noncoding RNA in immune defense mechanisms and suggests that their modulation could serve as a potential strategy for targeted therapies for various diseases.

Author Contributions

P.Q., B.G. and X.Y. conceptualization, methodology, writing—reviewing and editing; X.C., L.Q., X.S., X.Z. and Z.L. data curation, software, writing—original draft preparation. All authors have read and agreed to the published version of the manuscript.

Institutional Review Board Statement

The study was conducted according to Institution Animals Care and Use Committee of Zhejiang (identification code: 2023002; date of approval: 1 February 2023).

Informed Consent Statement

Not applicable.

Data Availability Statement

Requests for access to the data, statistical code, questionnaires, and technical processes may be made by contacting the corresponding author at [email protected], [email protected].

Conflicts of Interest

The authors declare no conflict of interest.

Footnotes

Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Figures and Table

Figure 1. Molecular characterization of McIL-17-3. (A) Architecture analysis of conserved domains in McIL-17-3 using SMART. A conserved IL-17 domain was shown. (B) Phylogenetic analysis of McIL-17-3. The phylogenetic tree was constructed using MEGAX software with 2000 replications of bootstrapping using the neighbor-joining method. McIL-17-3 was labeled with a green triangle. Species included in the phylogenetic tree were all retrieved from the Genebank database, and accession numbers were also listed in the tree. Green triangle on behalf of McIL-17-3. (For interpretation of the references to color in this figure legend, the reader is referred to the Web version of this article.)

Figure 2. Multiple alignment of McIL-17-3 with other IL-17 family members. (A) The amino acid sequence of McIL-17-3 was aligned with that of other IL-17s retrieved from mussels and vertebrates, including mice and zebrafish. These cysteines, which form a canonical knot, were marked with green, with replaced amino acid residues marked with red. The cysteines knot is indicated by color lines, and blue meaning their presence in molluscs and red meaning their presence in vertebrates. Note: Only the second half of the sequence alignment is preserved for visualization. (B) The tertiary structure of McIL-17-3 protein was predicted using the Swiss model and pyMol software. These cysteines, which form a canonical knot, were marked. (C) A cartoon representation of the canonical cysteine-knot fold. Cysteine residues were indicated by filled circles; those present in IL-17 proteins were yellow, whereas the two missed were gray. (For interpretation of the references to color in this figure legend, the reader is referred to the Web version of this article.)

Figure 3. Expression profile analysis of McIL-17-3 transcripts. (A) Distribution of McIL-17-3 transcripts in common mussel tissues. (B) Temporal expression changes of McIL-17-3 transcripts in response to V. alginolyticus challenge. The results were expressed as mean ± SD (n = 3, * p < 0.05, ** p < 0.01). (For interpretation of the references to color in this figure legend, the reader is referred to the Web version of this article.)

Figure 4. The activation of NF-κB reporter by McIL-17-3. The recombinant vector pEGFP-McIL-17-3 in three concentrations (0.1, 0.5, and 1.0 µg/well) was cotransfected into HEK293 cells using Lipo6000TM for 24 h. The relative luciferase activities were calculated by normalizing to the pRL-TK value. The experimental results were expressed as fold changes by comparing the luciferase activities of recombinant vector-induced cells with those of empty vector-induced cells at the same concentration. Each value was shown as mean ± SD (n = 3), and bars with an asterisk symbol were significantly different (* p < 0.05, ** p < 0.01).

Figure 5. Mc-novel_miR_145 targeted McIL-17-3. (A) The McIL-17-3 3′ UTR sequence was inserted into the pmiR-RB-Report™ vector, respectively constructed wild-type and mutant plasmids. Mc-novel_miR_145 sequence and McIL-17-3-3′UTR target site and mutant site sequence were labeled with red markers. (B) McIL-17-3-3′ UTR-WT plasmid was co-transfected with Mc-novel_miR_145 mimic or Mc-novel_miR_145 inhibitor into HEK293 cells. (C) HEK293 cells were transfected with McIL-17-3-3′UTR-WT or the mutant type of McIL-17-3-3′UTR-MUT, together with Mc-novel_miR_145 or NC, for 24 h. The luciferase activity was measured using the dual-luciferase reporter assay system. (D) The concentration gradient experiments were conducted for Mc-novel_miR_145 transfection. All data are presented as the means ± SD from at least three independent triplicated experiments. **, p < 0.01, *, p < 0.05 versus the controls. (For interpretation of the references to color in this figure legend, the reader is referred to the Web version of this article.)

Figure 6. Mc-novel_miR_145 inhibited the expression of McIL-17-3 in M. coruscus hemocytes. (A) The expression of Mc-novel_miR_145 was assessed by qPCR in hemocytes transfected with 145 mimic, 145 inhibitor and their respective control. (B) After transfection for 24 h, the transcriptional levels of McIL-17-3 were determined by qPCR. (C) Recombinant expression, purification, and the antiserum preparation for McIL-17-3. Lane M, standard protein molecular weight marker. Lane 1, negative control (without induction). Lane 2, induced recombinant protein McIL-17-3. Lane 3, purified McIL-17-3. Lane 4, Western blot with anti-McIL-17-3 antibody in the hemocytes of M. coruscus. (D) After transfection for 24 h, the protein levels of McIL-17-3 were determined by Western blot. ** p < 0.01 versus the controls.

Figure 7. The hemocyte apoptotic rate was assessed by flow cytometry using propidium iodide (PI) and FITC-Annexin-V staining. (A) Flow cytometry quadrant diagram. The control group was represented by (a): hemocytes with LPS challenge for 24 h. The experimental group by (b–d) with pEGFP-McIL-17-3 vector, Mc-novel_miR_145 + pEGFP-McIL-17-3, and Mc-novel_miR_145-I + pEGFP-McIL-17-3 addition. The numbers in the lower right quadrant (FITC+/PI−) represented the percentage of total fluorescence positive for early apoptosis; and the right upper quadrant (FITC+/PI+), total fluorescence positive for late apoptosis. (B) Significance test of the apoptotic rate. The vertical bars represent the mean ± SD. (n = 3, p < 0.05 *).

Table 1

PCR primer pairs used in the present study.

Primer	Sequences (5′–3′)	Usage
U6	CTCGCTTCGGCAGCACA	Internal reference for miRNAs qPCR
	AACGCTTCACGAATTTGCGT
β-actin	ATGAAACCACCTACAACAGT	Internal reference for qPCR
	TAGACCCACCAATCCAGACG
McIL-17-3	TGCTCATTTGGTAGATCACGGA	For McIL-17-3 qPCR
	GCACTGTATGGCGTTTGCTC
Mc-Novel_miR_145-F	ACACTCCAGCTGGGUCCAGAAAAGCGCUU	For Mc-novel_miR_145 qPCR
McIL-17-3-F	AAGGATCCATGTATTTTATCAATATACTTA	For pEGFP-McIL-17-3 plasmid construction
McIL-17-3-R	CCGCTCGAGTTCTTCTGGTCCATCAGCTGGA
McIL-17-3-YF	CACGAATTCATGTATTTTATCAATATACTTA	For pET32a-McIL-17-3 plasmid construction
McIL-17-3-YR	GACGGATCCTTCTTCTGGTCCATCAGCTGGA
McIL-17-3-3′UTR-WT-F	CCGCTCGAGTATGTGAACAGCCAAGAGAAGTCGCAAATGATGTA	For McIL-17-3-3′UTR-WT plasmid construction
McIL-17-3-3′UTR-WT-R	GCGGCCGCAAACAGAATACAAAAAACCCTTTATATGGCAAGTTG

References

1. Medzhitov, R.; Janeway, C., Jr. Innate immunity. N. Engl. J. Med.; 2000; 343, pp. 338-344. [DOI: https://dx.doi.org/10.1056/NEJM200008033430506] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/10922424]

2. Lacy, P.; Stow, J.L. Cytokine release from innate immune cells: Association with diverse membrane trafficking pathways. Blood J. Am. Soc. Hematol.; 2011; 118, pp. 9-18. [DOI: https://dx.doi.org/10.1182/blood-2010-08-265892] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/21562044]

3. Dinarello, C.A. Proinflammatory cytokines. Chest; 2000; 118, pp. 503-508. [DOI: https://dx.doi.org/10.1378/chest.118.2.503] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/10936147]

4. Rauta, P.R.; Nayak, B.; Das, S. Immune system and immune responses in fish and their role in comparative immunity study: A model for higher organisms. Immunol. Lett.; 2012; 148, pp. 23-33. [DOI: https://dx.doi.org/10.1016/j.imlet.2012.08.003]

5. Hymowitz, S.G.; Filvaroff, E.H.; Yin, J.; Lee, J.; Cai, L.; Risser, P.; Maruoka, M.; Mao, W.; Foster, J.; Kelley, R.F. IL-17s adopt a cystine knot fold: Structure and activity of a novel cytokine, IL-17F, and implications for receptor binding. EMBO J.; 2001; 20, pp. 5332-5341. [DOI: https://dx.doi.org/10.1093/emboj/20.19.5332]

6. Buckley, K.M.; Ho, E.C.H.; Hibino, T.; Schrankel, C.S.; Schuh, N.W.; Wang, G.Z.; Rast, J.P. IL17 factors are early regulators in the gut epithelium during inflammatory response to Vibrio in the sea urchin larva. eLife; 2017; 6, e23481. [DOI: https://dx.doi.org/10.7554/eLife.23481]

7. Cua, D.J.; Tato, C.M. Innate IL-17-producing cells: The sentinels of the immune system. Nat. Rev. Immunol.; 2010; 10, pp. 479-489. [DOI: https://dx.doi.org/10.1038/nri2800]

8. Mills, K.H. IL-17 and IL-17-producing cells in protection versus pathology. Nat. Rev. Immunol.; 2022; 10, pp. 479-489. [DOI: https://dx.doi.org/10.1038/s41577-022-00746-9]

9. Hibino, T.; Loza-Coll, M.; Messier, C.; Majeske, A.J.; Cohen, A.H.; Terwilliger, D.P.; Buckley, K.M.; Brockton, V.; Nair, S.V.; Berney, K. The immune gene repertoire encoded in the purple sea urchin genome. Dev. Biol.; 2006; 300, pp. 349-365. [DOI: https://dx.doi.org/10.1016/j.ydbio.2006.08.065]

10. Albertin, C.B.; Simakov, O.; Mitros, T.; Wang, Z.Y.; Pungor, J.R.; Edsinger-Gonzales, E.; Brenner, S.; Ragsdale, C.W.; Rokhsar, D.S. The octopus genome and the evolution of cephalopod neural and morphological novelties. Nature; 2015; 524, pp. 220-224. [DOI: https://dx.doi.org/10.1038/nature14668]

11. Saco, A.; Rey-Campos, M.; Rosani, U.; Novoa, B.; Figueras, A. The evolution and diversity of interleukin-17 highlight an expansion in marine invertebrates and its conserved role in mucosal immunity. Front. Immunol.; 2021; 12, 692997. [DOI: https://dx.doi.org/10.3389/fimmu.2021.692997] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/34386003]

12. Gerdol, M.; Moreira, R.; Cruz, F.; Gómez-Garrido, J.; Vlasova, A.; Rosani, U.; Venier, P.; Naranjo-Ortiz, M.A.; Murgarella, M.; Greco, S. Massive gene presence-absence variation shapes an open pan-genome in the Mediterranean mussel. Genome Biol.; 2020; 21, pp. 1-21. [DOI: https://dx.doi.org/10.1186/s13059-020-02180-3]

13. Cao, Y.; Yang, S.; Feng, C.; Zhan, W.; Zheng, Z.; Wang, Q.; Deng, Y.; Jiao, Y.; Du, X. Evolution and function analysis of interleukin-17 gene from Pinctada fucata martensii. Fish Shellfish Immunol.; 2019; 88, pp. 102-110. [DOI: https://dx.doi.org/10.1016/j.fsi.2019.02.044] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/30802631]

14. Wang, Q.; Xiao, G.; Hu, G.; Chen, R.; Li, M.; Teng, S. Interleukin-17D mediates Vibrio harveyi infection-related changes in Tegillarca granosa though activation of activator protein 1 in vivo. Aquaculture; 2023; 566, 739178. [DOI: https://dx.doi.org/10.1016/j.aquaculture.2022.739178]

15. Lv, X.; Sun, J.; Li, Y.; Yang, W.; Wang, L.; Leng, J.; Yan, X.; Guo, Z.; Yang, Q.; Wang, L. CgIL17-5 regulates the mRNA expressions of immune effectors through inducing the phosphorylation of CgMAPKs and the nuclear translocation of CgRel and CgAP-1 in the Pacific oyster Crassostrea gigas. Dev. Comp. Immunol.; 2022; 127, 104263. [DOI: https://dx.doi.org/10.1016/j.dci.2021.104263] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/34563588]

16. Wang, L.; Sun, J.; Wu, Z.; Lian, X.; Han, S.; Huang, S.; Yang, C.; Wang, L.; Song, L. AP-1 regulates the expression of IL17-4 and IL17-5 in the pacific oyster Crassostrea gigas. Fish Shellfish Immunol.; 2020; 97, pp. 554-563. [DOI: https://dx.doi.org/10.1016/j.fsi.2019.12.080]

17. Wu, S.-Z.; Huang, X.-D.; Li, Q.; He, M.-X. Interleukin-17 in pearl oyster (Pinctada fucata): Molecular cloning and functional characterization. Fish Shellfish Immunol.; 2013; 34, pp. 1050-1056. [DOI: https://dx.doi.org/10.1016/j.fsi.2013.01.005]

18. Xin, L.; Zhang, H.; Zhang, R.; Li, H.; Wang, W.; Wang, L.; Wang, H.; Qiu, L.; Song, L. CgIL17-5, an ancient inflammatory cytokine in Crassostrea gigas exhibiting the heterogeneity functions compared with vertebrate interleukin17 molecules. Dev. Comp. Immunol.; 2015; 53, pp. 339-348. [DOI: https://dx.doi.org/10.1016/j.dci.2015.08.002]

19. Denli, A.M.; Tops, B.B.; Plasterk, R.H.; Ketting, R.F.; Hannon, G.J. Processing of primary microRNAs by the Microprocessor complex. Nature; 2004; 432, pp. 231-235. [DOI: https://dx.doi.org/10.1038/nature03049]

20. Khan, D.; Ansar Ahmed, S. Regulation of IL-17 in autoimmune diseases by transcriptional factors and microRNAs. Front. Genet.; 2015; 6, 236. [DOI: https://dx.doi.org/10.3389/fgene.2015.00236]

21. Martín-Gómez, L.; Villalba, A.; Kerkhoven, R.H.; Abollo, E. Role of microRNAs in the immunity process of the flat oyster Ostrea edulis against bonamiosis. Infect. Genet. Evol.; 2014; 27, pp. 40-50. [DOI: https://dx.doi.org/10.1016/j.meegid.2014.06.026] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/25008434]

22. Xu, F.; Wang, X.; Feng, Y.; Huang, W.; Wang, W.; Li, L.; Fang, X.; Que, H.; Zhang, G. Identification of conserved and novel microRNAs in the Pacific oyster Crassostrea gigas by deep sequencing. PLoS ONE; 2014; 9, e104371. [DOI: https://dx.doi.org/10.1371/journal.pone.0104371]

23. Zhou, Z.; Wang, L.; Song, L.; Liu, R.; Zhang, H.; Huang, M.; Chen, H. The identification and characteristics of immune-related microRNAs in haemocytes of oyster Crassostrea gigas. PLoS ONE; 2014; 9, e88397. [DOI: https://dx.doi.org/10.1371/journal.pone.0088397] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/24516648]

24. Burgos-Aceves, M.A.; Cohen, A.; Smith, Y.; Faggio, C. A potential microRNA regulation of immune-related genes in invertebrate haemocytes. Sci. Total Environ.; 2018; 621, pp. 302-307. [DOI: https://dx.doi.org/10.1016/j.scitotenv.2017.11.285]

25. Walker, S.E.; Spencer, G.E.; Necakov, A.; Carlone, R.L. Identification and characterization of microRNAs during retinoic acid-induced regeneration of a molluscan central nervous system. Int. J. Mol. Sci.; 2018; 19, 2741. [DOI: https://dx.doi.org/10.3390/ijms19092741] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/30217012]

26. Abo-Al-Ela, H.G.; Faggio, C. MicroRNA-mediated stress response in bivalve species. Ecotoxicol. Environ. Saf.; 2021; 208, 111442. [DOI: https://dx.doi.org/10.1016/j.ecoenv.2020.111442] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/33038725]

27. Huang, S.; Yoshitake, K.; Asaduzzaman, M.; Kinoshita, S.; Watabe, S.; Asakawa, S. Discovery and functional understanding of MiRNAs in molluscs: A genome-wide profiling approach. RNA Biol.; 2021; 18, pp. 1702-1715. [DOI: https://dx.doi.org/10.1080/15476286.2020.1867798]

28. Rosani, U.; Bortoletto, E.; Bai, C.-M.; Novoa, B.; Figueras, A.; Venier, P.; Fromm, B. Digging into bivalve miRNAomes: Between conservation and innovation. Philos. Trans. R. Soc. B; 2021; 376, 20200165. [DOI: https://dx.doi.org/10.1098/rstb.2020.0165]

29. Sun, X.; Zhang, T.; Li, L.; Tu, K.; Yu, T.; Wu, B.; Zhou, L.; Tian, J.; Liu, Z. MicroRNA expression signature in the striated and smooth adductor muscles of Yesso scallop Patinopecten yessoensis. Genomics; 2022; 114, 110409. [DOI: https://dx.doi.org/10.1016/j.ygeno.2022.110409]

30. Tian, R.; Zheng, Z.; Huang, R.; Jiao, Y.; Du, X. miR-29a participated in nacre formation and immune response by targeting Y2R in Pinctada martensii. Int. J. Mol. Sci.; 2015; 16, pp. 29436-29445. [DOI: https://dx.doi.org/10.3390/ijms161226182]

31. Chen, H.; Zhou, Z.; Wang, H.; Wang, L.; Wang, W.; Liu, R.; Qiu, L.; Song, L. An invertebrate-specific and immune-responsive microRNA augments oyster haemocyte phagocytosis by targeting CgIκB2. Sci. Rep.; 2016; 6, pp. 1-10. [DOI: https://dx.doi.org/10.1038/srep29591] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/27404434]

32. Chen, H.; Zhou, Z.; Wang, L.; Wang, H.; Liu, R.; Zhang, H.; Song, L. An invertebrate-specific miRNA targeted the ancient cholinergic neuroendocrine system of oyster. Open Biol.; 2016; 6, 160059. [DOI: https://dx.doi.org/10.1098/rsob.160059]

33. Chen, H.; Xin, L.; Song, X.; Wang, L.; Wang, W.; Liu, Z.; Zhang, H.; Wang, L.; Zhou, Z.; Qiu, L. A norepinephrine-responsive miRNA directly promotes CgHSP90AA1 expression in oyster haemocytes during desiccation. Fish Shellfish Immunol.; 2017; 64, pp. 297-307. [DOI: https://dx.doi.org/10.1016/j.fsi.2017.03.020] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/28286314]

34. Han, Z.; Li, J.; Wang, W.; Li, J.; Zhao, Q.; Li, M.; Wang, L.; Song, L. A calmodulin targeted by miRNA scaffold659_26519 regulates IL-17 expression in the early immune response of oyster Crassostrea gigas. Dev. Comp. Immunol.; 2021; 124, 104180. [DOI: https://dx.doi.org/10.1016/j.dci.2021.104180] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/34171368]

35. Lv, Z.; Li, C.; Zhang, P.; Wang, Z.; Zhang, W.; Jin, C.-H. miR-200 modulates coelomocytes antibacterial activities and LPS priming via targeting Tollip in Apostichopus japonicus. Fish Shellfish Immunol.; 2015; 45, pp. 431-436. [DOI: https://dx.doi.org/10.1016/j.fsi.2015.04.014]

36. Li, C.; Zhao, M.; Zhang, C.; Zhang, W.; Zhao, X.; Duan, X.; Xu, W. miR210 modulates respiratory burst in Apostichopus japonicus coelomocytes via targeting Toll-like receptor. Dev. Comp. Immunol.; 2016; 65, pp. 377-381. [DOI: https://dx.doi.org/10.1016/j.dci.2016.08.008]

37. Lv, M.; Chen, H.; Shao, Y.; Li, C.; Zhang, W.; Zhao, X.; Jin, C.; Xiong, J. miR-92a regulates coelomocytes apoptosis in sea cucumber Apostichopus japonicus via targeting Aj14-3-3ζ in vivo. Fish Shellfish Immunol.; 2017; 69, pp. 211-217. [DOI: https://dx.doi.org/10.1016/j.fsi.2017.08.033]

38. Shao, Y.; Li, C.; Xu, W.; Zhang, P.; Zhang, W.; Zhao, X. miR-31 links lipid metabolism and cell apoptosis in bacteria-challenged Apostichopus japonicus via targeting CTRP9. Front. Immunol.; 2017; 8, 263. [DOI: https://dx.doi.org/10.3389/fimmu.2017.00263]

39. Guo, M.; Wang, Y.; Fu, X.; Tao, W.; Li, C. circRNA1149 from Apostichopus japonicus suppresses coelomocyte apoptosis act as miR-92a sponge to regulate Bax expression in response to Vibrio splendidus infection. Aquaculture; 2023; 562, 738812. [DOI: https://dx.doi.org/10.1016/j.aquaculture.2022.738812]

40. Zuo, H.; Weng, K.; Luo, M.; Yang, L.; Weng, S.; He, J.; Xu, X. A MicroRNA-1–Mediated Inhibition of the NF-κB Pathway by the JAK-STAT Pathway in the Invertebrate Litopenaeus vannamei. J. Immunol.; 2020; 204, pp. 2918-2930. [DOI: https://dx.doi.org/10.4049/jimmunol.2000071]

41. Yang, H.; Xu, Z.; Guo, B.; Zhang, X.; Liao, Z.; Qi, P.; Yan, X. Integrated analysis of miRNAome and transcriptome reveals miRNA-mRNA network regulation in Vibrio alginolyticus infected thick shell mussel Mytilus coruscus. Mol. Immunol.; 2021; 132, pp. 217-226. [DOI: https://dx.doi.org/10.1016/j.molimm.2021.01.006] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/33478821]

42. de Morales, J.M.G.R.; Puig, L.; Daudén, E.; Cañete, J.D.; Pablos, J.L.; Martín, A.O.; Juanatey, C.G.; Adán, A.; Montalbán, X.; Borruel, N. Critical role of interleukin (IL)-17 in inflammatory and immune disorders: An updated review of the evidence focusing in controversies. Autoimmun. Rev.; 2020; 19, 102429. [DOI: https://dx.doi.org/10.1016/j.autrev.2019.102429] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/31734402]

43. Kawaguchi, M.; Adachi, M.; Oda, N.; Kokubu, F.; Huang, S.-K. IL-17 cytokine family. J. Allergy Clin. Immunol.; 2004; 114, pp. 1265-1273. [DOI: https://dx.doi.org/10.1016/j.jaci.2004.10.019] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/15577820]

44. Starnes, T.; Broxmeyer, H.E.; Robertson, M.J.; Hromas, R. Cutting edge: IL-17D, a novel member of the IL-17 family, stimulates cytokine production and inhibits hemopoiesis. J. Immunol.; 2002; 169, pp. 642-646. [DOI: https://dx.doi.org/10.4049/jimmunol.169.2.642] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/12097364]

45. Gaffen, S.L.; Kramer, J.M.; Jeffrey, J.Y.; Shen, F. The IL-17 cytokine family. Vitam. Horm.; 2006; 74, pp. 255-282. [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/17027518]

46. Roberts, S.; Gueguen, Y.; de Lorgeril, J.; Goetz, F. Rapid accumulation of an interleukin 17 homolog transcript in Crassostrea gigas hemocytes following bacterial exposure. Dev. Comp. Immunol.; 2008; 32, pp. 1099-1104. [DOI: https://dx.doi.org/10.1016/j.dci.2008.02.006] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/18395796]

47. Li, J.; Zhang, Y.; Zhang, Y.; Xiang, Z.; Tong, Y.; Qu, F.; Yu, Z. Genomic characterization and expression analysis of five novel IL-17 genes in the Pacific oyster, Crassostrea gigas. Fish Shellfish Immunol.; 2014; 40, pp. 455-465. [DOI: https://dx.doi.org/10.1016/j.fsi.2014.07.026]

48. Gaffen, S.L. Structure and signalling in the IL-17 receptor family. Nat. Rev. Immunol.; 2009; 9, pp. 556-567. [DOI: https://dx.doi.org/10.1038/nri2586]

49. Hata, K.; Andoh, A.; Shimada, M.; Fujino, S.; Bamba, S.; Araki, Y.; Okuno, T.; Fujiyama, Y.; Bamba, T. IL-17 stimulates inflammatory responses via NF-κB and MAP kinase pathways in human colonic myofibroblasts. Am. J. Physiol. -Gastrointest. Liver Physiol.; 2002; 282, pp. G1035-G1044. [DOI: https://dx.doi.org/10.1152/ajpgi.00494.2001]

50. Niimoto, T.; Nakasa, T.; Ishikawa, M.; Okuhara, A.; Izumi, B.; Deie, M.; Suzuki, O.; Adachi, N.; Ochi, M. MicroRNA-146a expresses in interleukin-17 producing T cells in rheumatoid arthritis patients. BMC Musculoskelet. Disord.; 2010; 11, pp. 1-11. [DOI: https://dx.doi.org/10.1186/1471-2474-11-209]

51. Srivastava, A.; Nikamo, P.; Lohcharoenkal, W.; Li, D.; Meisgen, F.; Landén, N.X.; Ståhle, M.; Pivarcsi, A.; Sonkoly, E. MicroRNA-146a suppresses IL-17–mediated skin inflammation and is genetically associated with psoriasis. J. Allergy Clin. Immunol.; 2017; 139, pp. 550-561. [DOI: https://dx.doi.org/10.1016/j.jaci.2016.07.025] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/27568078]

52. Zhao, S.; Cheng, Y.; Kim, J.G. microRNA-146a downregulates IL-17 and IL-35 and inhibits proliferation of human periodontal ligament stem cells. J. Cell. Biochem.; 2019; 120, pp. 13861-13866. [DOI: https://dx.doi.org/10.1002/jcb.28659] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/30989711]

53. Podsiad, A.; Standiford, T.J.; Ballinger, M.N.; Eakin, R.; Park, P.; Kunkel, S.L.; Moore, B.B.; Bhan, U. MicroRNA-155 regulates host immune response to postviral bacterial pneumonia via IL-23/IL-17 pathway. Am. J. Physiol. -Lung Cell. Mol. Physiol.; 2016; 310, pp. L465-L475. [DOI: https://dx.doi.org/10.1152/ajplung.00224.2015]

54. Xaus, J.; Comalada, M.; Valledor, A.F.; Lloberas, J.; López-Soriano, F.; Argilés, J.M.; Bogdan, C.; Celada, A. LPS induces apoptosis in macrophages mostly through the autocrine production of TNF-α. Blood J. Am. Soc. Hematol.; 2000; 95, pp. 3823-3831.

55. Bannerman, D.D.; Goldblum, S.E. Mechanisms of bacterial lipopolysaccharide-induced endothelial apoptosis. Am. J. Physiol.-Lung Cell. Mol. Physiol.; 2003; 284, pp. L899-L914. [DOI: https://dx.doi.org/10.1152/ajplung.00338.2002]

56. Brass, D.M.; Hollingsworth, J.W.; Cinque, M.; Li, Z.; Potts, E.; Toloza, E.; Foster, W.M.; Schwartz, D.A. Chronic LPS inhalation causes emphysema-like changes in mouse lung that are associated with apoptosis. Am. J. Respir. Cell Mol. Biol.; 2008; 39, pp. 584-590. [DOI: https://dx.doi.org/10.1165/rcmb.2007-0448OC]

57. Dragon, S.; Saffar, A.S.; Shan, L.; Gounni, A.S. IL-17 attenuates the anti-apoptotic effects of GM-CSF in human neutrophils. Mol. Immunol.; 2008; 45, pp. 160-168. [DOI: https://dx.doi.org/10.1016/j.molimm.2007.04.027] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/17555818]

58. Zhu, F.; Wang, Q.; Guo, C.; Wang, X.; Cao, X.; Shi, Y.; Gao, F.; Ma, C.; Zhang, L. IL-17 induces apoptosis of vascular endothelial cells—A potential mechanism for human acute coronary syndrome. Clin. Immunol.; 2011; 141, pp. 152-160. [DOI: https://dx.doi.org/10.1016/j.clim.2011.07.003]

59. Chang, Y.; Al-Alwan, L.; Audusseau, S.; Chouiali, F.; Carlevaro-Fita, J.; Iwakura, Y.; Baglole, C.J.; Eidelman, D.H.; Hamid, Q. Genetic deletion of IL-17A reduces cigarette smoke-induced inflammation and alveolar type II cell apoptosis. Am. J. Physiol. -Lung Cell. Mol. Physiol.; 2014; 306, pp. L132-L143. [DOI: https://dx.doi.org/10.1152/ajplung.00111.2013]

60. Hou, W.; Jin, Y.-H.; Kang, H.S.; Kim, B.S. Interleukin-6 (IL-6) and IL-17 synergistically promote viral persistence by inhibiting cellular apoptosis and cytotoxic T cell function. J. Virol.; 2014; 88, pp. 8479-8489. [DOI: https://dx.doi.org/10.1128/JVI.00724-14]

61. Wang, Q.; Li, D.; Han, Y.; Ding, X.; Xu, T.; Tang, B. MicroRNA-146 protects A549 and H1975 cells from LPS-induced apoptosis and inflammation injury. J. Biosci.; 2017; 42, pp. 637-645. [DOI: https://dx.doi.org/10.1007/s12038-017-9715-4] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/29229881]

62. Chen, Y.; Wu, Z.; Yuan, B.; Dong, Y.; Zhang, L.; Zeng, Z. MicroRNA-146a-5p attenuates irradiation-induced and LPS-induced hepatic stellate cell activation and hepatocyte apoptosis through inhibition of TLR4 pathway. Cell Death Dis.; 2018; 9, pp. 1-16. [DOI: https://dx.doi.org/10.1038/s41419-017-0038-z] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/29348414]

63. Ding, Y.; Wang, L.; Zhao, Q.; Wu, Z.; Kong, L. MicroRNA-93 inhibits chondrocyte apoptosis and inflammation in osteoarthritis by targeting the TLR4/NF-κB signaling pathway. Int. J. Mol. Med.; 2019; 43, pp. 779-790. [DOI: https://dx.doi.org/10.3892/ijmm.2018.4033]

64. Wan, G.; An, Y.; Tao, J.; Wang, Y.; Zhou, Q.; Yang, R.; Liang, Q. MicroRNA-129-5p alleviates spinal cord injury in mice via suppressing the apoptosis and inflammatory response through HMGB1/TLR4/NF-κB pathway. Biosci. Rep.; 2020; 40, BSR20193315. [DOI: https://dx.doi.org/10.1042/BSR20193315] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/32096822]

65. Ke, X.-F.; Fang, J.; Wu, X.-N.; Yu, C.-H. MicroRNA-203 accelerates apoptosis in LPS-stimulated alveolar epithelial cells by targeting PIK3CA. Biochem. Biophys. Res. Commun.; 2014; 450, pp. 1297-1303. [DOI: https://dx.doi.org/10.1016/j.bbrc.2014.06.125] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/24996183]

66. Qi, P.; Tang, Z. The Nrf2 molecule trigger antioxidant defense against acute benzo(a)pyrene exposure in the thick shell mussel Mytilus coruscus. Aquat Toxicol; 2020; 226, 105554. [DOI: https://dx.doi.org/10.1016/j.aquatox.2020.105554]

67. Schmittgen, T.D.; Livak, K.J. Analyzing real-time PCR data by the comparative CT method. Nat. Protoc.; 2008; 3, pp. 1101-1108. [DOI: https://dx.doi.org/10.1038/nprot.2008.73]