Identification, isolation, cloning and sequencing of tannase gene from Aspergillus niger

Headnote

Abstract

Introduction and objective: Tannin acyl hydrolase (tannase E.C. 3.1.1.20), commonly referred to as tannase, hydrolyses the 'ester' bond (galloyl ester of an alcohol moiety) and the 'depside' bond (galloyl ester of gallic acid) in substrates such as tannic acid, methylgallate and m-digallic acid. This is an inducible enzyme produced by various filamentous fungi. The aim of present research was to isolate, clone and sequence partial gene of tannase from Aspergillus niger.

Materials and methods: Aspergillus niger was grown in a selective medium and then genomic DNA was directly extracted from fungal mycelium. Using designed primers, PCR carried out and a 950bp expected band obtained that was ligated into cloning vector and then cloned into Escherichia coli Top-10F'. In order to screen transformed cells, the blue/white bacterial colony selection was carried out and expected the inserted DNA was extracted from putative transformants cells.

Results: Extracted DNA was sequenced using ABI automatic system and a 908bp intronlees motif was obtained using BlastX anal ay sing software that showed 36% identity with tannase precursor of A. oryzae and 29% with Debaryomyces hansenii tannase gene in amino acid level.

Conclusion: In conclusion, the identification, isolation, cloning and sequencing of a 908bp partial sequence of tannase gene from A. niger which is considered as an important bioreactor and industrial fungus were reported.

Keywords: Cloning; Tannase; Gene sequence; Aspergillus niger

Introduction

Microorganisms need to produce a combination of enzymes, primarily carbohydrases and 'esterases' (able to remove side chain substituents) that act synergistically, in order to increase their ability to use different substrates [1,2]. Between these enzymes, microbial esterases are a broad group of enzymes able to hydrolyse the ester bond of a variety of naturally occurring esters [3].

Tannin acyl hydrolase (tannase E.C. 3.1.1 .20), commonly referred to as tannases, hydrolyses the 'ester' bond (galloyl ester of an alcohol moiety) and the 'depside' bond (galloyl ester of gallic acid) in substrates such as tannic acid, methylgallate and mdigallic acid [1,4,5]. In some filamentous fungi like A. oryzae, the presence of two separate isoenzymes, tannase I and tannase II, with esterase and depsidase activity, respectively, have been described [6]. These are inducible enzymes produced mainly by Aspergillus, Pénicillium and Rhizopus species [4,7-9] but have also been described in yeast [4], bacteria [10], and plants such as Pedunculate oak [11].

Gallic acid is the product of acidic or enzymatic hydrolysis of tannic acid and is taken into account as an important substrate for the synthesis of propyl gallate in the food industry and trimethoprim in the pharmaceutical industry. Pyrogallol, the product of tannase and gallic acid decarboxylase, has widespread industrial applications; it is used as a developer in photography, for staining leather, fur, and hair, as a precursor for dyes, and for determining oxygen concentrations in gas analyses [1,6,9]. Gallic acid decarboxylases catalyze the second step in the degradation of the polyphenol tannic acid, the decarboxylation of gallic acid to pyrogallol [1,4]. Tannase also has potential applications in the clarification of beer and fruit juices, manufacture of coffee flavoured soft drinks, improvement in the flavour of grape wine and as an analytical probe for determining the structures of naturally occurring gallic acid esters [3].

Aspergillus niger has been used as an important bioreactor to prepare different type of industrial enzymes and materials. A. niger also releases large amounts of citric acid into the environment, causing it to become acidic. To adapt to this acidic environment, some of the enzymes of A. niger such as tannase, amylase, protease, cellulase, and hemicellulase, are more acid stable than the same enzymes secreted by other bacterial and fungal species. Moreover optimum temperature for the A. niger tannase activity (70°C) was considerably higher than those of tannases produced in other experiment [4,7]. The purified tannase so far from different sources have been shown to have a molecular mass of 90kDa to over 300 [12].

Identification and sequencing of tannase gene in A. niger has not been preformed till this study and the aim of present study was to isolate, clone and sequence partial gene of tannase from A. niger.

Materials and methods

Wild type A. niger PTCC 5012 (similar to Csp Al derivative from ATCC 9029) was obtained from Iranian Centre of Industrial and Medical Fungi and Bacteria Collection. Escherichia coli Top-10F' competent cells were obtained from Invitrogen and were used for all cloning procedures. Potato dextrose agar (Oxoid, UK) was used for routinely growing fungus strain and Modified Vogel's Medium was prepared by filter sterilizing (0.2 µm) a 50x stock of Vogel's salts solution. For agar plates, 1.5% (w/v) agarose (Lucas Meyer, USA) was included with the sugar to solidify the medium.

Luria-Burtani Medium (LB) was prepared by autoclaving a solution containing standard agents. When required, 0.1% (v/v) of a filter sterilised solution of 50mg ml^sup -1^ ampicillin was added after autoclaving the medium. For the production of A. niger spores, fungus were grown at 25°C for five days in Vogel' s modified agar (Lucas Meyer, USA). To prepare spores, 10ml of sterile 0.1% (v/v) Tween 80, was spread on the surface of the mycelium and spores were collected by gently scraping the surface of the colonies with a flame-sterilised glass spreader and filtered through Whatman lens tissue to remove mycelial fragments and then and stored at 4°C.

To prepare plasmid, 2ml or 4ml of LB broth (containing 1-2µl of a filter sterilised 50mg ml^sup -1^ ampicillin stock solution), was inoculated with E. coli Top-10F' from a colony and incubated overnight at 37°C (250rpm). Genomic DNA was extracted from approximately 1.4g of mycelium (wet weight) from 18h liquid cultures of A. niger using the method described by Griffin et al. [13]. To rapidly screen the recombinant transformants, plasmid DNA was prepared from cultures using the boiling method and stored at -20°C until required. Digestion of DNA was carried out using restriction endonucleases (Boegringer Mannheim) and the appropriate 1x buffer, usually in a volume of 10µl. For genomic DNA, the digestion was performed overnight at 37°C. To obtain plasmid DNA, digests were usually performed at 37°C for 2h.

Usually, PCR products were gel purified and cloned into E. coli Top-10F' (Stratagene) using standard cloning procedures. PCR products were cloned using the pGEM®-T easy vector system (Promega, USA). Ligation reactions were typically carried out by incubating ?µ? of 10x reaction buffer, 1µl vector (50ngµl^sup -1^), 100 ngµl^sup -1^ purified PCR product and sterile ddH2O (to make a final volume of 10µl) and incubated at 4°C overnight.

Blue/white colony selection

The insertion of DNA into α peptide, part of the β-galactosidase gene encoded by pGEM®-T easy vector inactivates the gene. Therefore, transformed colonies containing the PCR product plasmid can not produce the active enzyme. This effect can degrade the colorimetrie substrate 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside (X-gal) and release the blue coloured product. After growing transformed colonies bluewhite colony selection was carried out on ampicillin agar plates containing 0. 0265mg ml^sup -1^ X-gal and 0.3mg ml^sup -1^ Isopropyl β-D-thiogalactopyranoside (IPTG).

To confirm the presence of expected DNA insertion, the plasmid was digested by EcoR1 restriction enzyme. Digested plasmid was run on 1% (w/v) agarose gel which was stained using ethidium bromide bath. All DNA products that required sequencing were cloned using the pGEM®-T easy vector and sent either to MWG or Lark Technology for sequencing.

Forward and reverse degenerate primers (TTCTGCTCTGGATCGCAATCTG and ACTAGTGATTGATGGGGGAGAGG) for tannase gene were designed from highly conserved regions of amino acids from an alignment of the translated sequences of tannase gene from several sources. The process of PCR degenerate was performed as follows: 3min 94°C x1, 1min 94°C, 1min 48°C, 3mins 72°C x 29, lmin 94°C, 1min 48°C, 7mins 72°C x1. PCR with above conditions produced a clear product of ca. 950bp with A. niger genomic DNA which was the size of product predicted (Fig. 1).

Bioinformatics tools

A range of web-based tools were used for analysis of DNA and protein sequences. Novel DNA sequences were submitted for analysis through the BLASTX. BLAST was accessed through the NCBI (http://www.ncbi.nlm.nih.gov/) or through the Bioinformatics Centre, University of Kyoto (http://blast.genome.ad.jp/) to search for sequence similarity. DNA-to-protein translation of DNA sequences was performed using the EXPASY translate tool (http://au.expasy.org/tools/dna. html) using the standard genetic code. To compare reverse and forward strand sequences, one strand was reverse complimented prior to alignment using the reverse and compliment program at Lipper Centre for Computational Genetics, Harvard (http://arep.med.harvard.edu/labgc/adnan/projects/Utilities/revcomp.html).

Results

Sequence analysis

Three clones containing product inserts of ca. 950bp were sent externally to sequence after plasmid DNA isolation. After removal of 5' and 3' vector sequence and primers, sequences were subjected to multiple alignments. All three clones were identical except for the clone which was on the opposite strand to the others. This was confirmed by multiple alignments of the nucleotide sequences after reverse complementing the third clone. When the sequence of the 950bp PCR product (Fig. 2) was analysed by BLASTX, the translated sequence showed a significant homology to fungal and other eukaryotic tannase genes. The partial tannase sequence was named antan 1 and shared a 36% identity with tannase precursor A. oryzae and 29% with Debaryomyces hansenii tannase at the amino acid level.

Southern analysis

The 950bp insert from plasmid pGEM®-T Easy vector was cut from the plasmid with Eco RI and labelled with digoxigenin and was used to probe A. niger DNA restricted with Apa I, Asp 718, Hind III, Sac I, Sma I, Xba I and Xho I. Southern analysis showed that the probe hybridised to a single band with each digest except Sac I (Fig. 3). The Apa I digest produced a band of 1.8Kb and a second band of 3.1Kb, the Asp 718 digest a 4.7Kb band, the Hind III digest a 6.5Kb band, the Sac I digest a band of 10.5Kb, the Sma I digest a 4.7Kb band, the Xba I digest a 1.4Kb band and the Xho I digest a 4.1Kb band.

Northern analysis

Cultures of A. niger were grown for 72h in modified Vogel's and after RNA extraction, the quality of total A. niger RNA was examined by non-denaturing gel electrophoresis. Two bands representing the 18S and 28S rRNA were clearly visible. After membrane blotting, the membrane was probed with the same digoxigenin labeled probe as used for Southern analysis. Northern analysis revealed a single transcript of ca. 3.8Kb hybridised to the antanl probe at stringency condition (a) and the other at non-stringency condition (b) (Fig. 4)

Discussion

Although during last few decades some tannase enzyme have been isolated, purificated and characterizated from Aspergillus species (A. oryzae, A. kawachii, A. avuleatus, A. niger, A. awamori) and described [4,7,8]; so far, the only genomic sequence of a functional tannase gene has been described from A. oryzae [12]. Both tannase from A. niger and the R-glucosidase from A. kawachii are partially intracellular when produced by liquid fermentation, extracellular under solid culture conditions [8] and also thermostable and unspecific. Such bifunctionality may be a survival way for micro-organisms such as Iactobacillus plantarum and A. niger during natural selection period to survive in extreme environments or to efficiently degrade cellulose and tannins, abundant in decaying plant material [8,12,14-17].

It is unknown whether the two functions (esterase for the tannase and hydrolase for the β-glucosidase) are carried out by one or two domains within the protein structure [18]. However there is a low chance that a single-domain protein, highly homologous to a known enzyme, has a different function [3,14]. In the present study, we cloned the partial sequence of gene the encoding tannase in A. niger and analyzed the sequence.

Nucleotide sequence analysis

The obtained sequence was a 908bp without any intron that encodes a 302 amino acid protein. From this 302 amino acid sequences only a 152 amino acid motif look like a valid motif that has been highlighted (Bold) at Figure 2. The amino acid sequence exhibited high levels of homology with the amino acid sequences of two tannase genes at NCBI.

To obtain partial sequence, we were neither able to recognize intron(s), TATAA-like, CCAAT (CAAT box), poly (A) sequences and nor predict starting or stopping codons and the CT rich sequence before starting codon. Therefore we were not able to hypothesize the C- and N terminal of peptide. Five possible CREA binding sites (5'-[G/C][C/T]GG[G/A]-3') [19] were present at positions 198, 592, 629, 721, and 851bp (under lined sequences) in the nucleotide sequence of motif suggesting significant carbon catabolite repression of tannase gene and deacylase activity can be affected at different carbon sources.

This sequence encoding is a binding site for the carbon catabolitite repression transcripn factor CREA [19]. Also no binding site was found for the transcriptional regulator PacC that regulate gene expression in response to external pH [20] (GCCARG) suggesting tannase gene is not PH regulated. Consensus internal intron sequence, TACTCAC did not found between GTATGT sequence and CAG sequence at 5' and 3' end of the above motif despite the presence of these sequences (Bold highlighted) in motif so it look like intronless motif as tannase full sequence from A. oryzae that has been cloned by Hatamoto et al. [12].

Also sequence encoding a binding site for the carbon catabolite repression transcription factor CREA [19] (SYGGRG) was not present in the amino acid level of motif suggesting no or very poor carbon catabolite repression of tannase gene and deacylase activity was found not to be significantly affected at different carbon sources. Also no binding site was found for the transcriptional regulator PacC [20] that regulate gene expression in response to external pH (GCCARG) suggesting tannase gene is not pH regulated [21].

Comparison of amino acid sequences

We searched the SwissProt database for sequences similar to the deduced amino acid sequence of obtained sequence. Significant levels of similarity were found with Tannase precursor (EC 3.1.1.20) [Contains: Tannase 33 kDa Subunit and Tannase 30kDa subunit] from A. oryzae with 37% identities (Medline and PubMed accession No. 97074675; & 8917102 respectively) and below characters: EMBL; D63338; BAA09656.1; PIR; JC5087; JC5087; InterPro; IPR01 11 18; Tannase; Pfam; PF07519; Tannase; 1. and Similar sequence to Sp. P78581 A. oryzae from Debaryomyces hansenii chromosome A of strain CBS767 with 29% identity and below character: EMBL; CR382133; CAG84949. 1 ; InterPro; IPRO 11118; Tannase; Pfam; PF07519; Tannase; 1.

Nucleotide sequence accession number

The nucleotide sequence reported in this paper has been submitted to NCBI GenBank under accession number AY727901. We emphasize that additional experiments are needed to clone and sequencing the full length of tannase gene from A. niger and then more fully understand the factors that regulate the activity and control the destination of enzyme and it's probable role in medical field [22]. Also additional studies of tannase mRNA transcription in solid and broth cultures are needed to understand the effective factors for expression of enzyme.

Conclusion

In conclusion, the ease of A. niger culture, the high level of enzyme production on different media, the high activity of tannase from this mould, and its very high tolerances to acidic condition and high temperature (70°C) are particularly favourable for the application of this enzyme in the biotechnological industry.

Sidebar

How to cite this article:

Kazemi A, Asghar Zade M, Jafari A. Identification, isolation, cloning and sequencing of tannase gene from Aspergillus niger. Jundishapur J Microbiol. 2011; 4(Supplement 1): S27-S34.

Received: August 2010 Accepted: November 2010

References

References

1) Mondai KC, Samanta S, Giri S, Pati BR. Distribution of tannic acid degrading microorganisms in the soil and comparative study of tannase from two fungal strains. Acta Microbiol Pol. 2001; 501: 75-82.

2) Haslam E, Stangroom JE. The esterase and depsidase activities of tannase. Biochem J. 1996;9:28-31.

3) Aguilar CN, Rodriguez R, Gutierrez-Sanchez G, et al. Microbial tannases: advances and perspectives. Appl Microbiol Biotechnol. 2007; 76: 47-59.

4) Seth M, Chand S. Biosynthesis of tannase and hydrolysis of tannins to gallic acid by Aspergillus awamori, optimization of process parameters. Process Biochem. 2000; 36: 39-44.

5) Van Diepeningen AD, Debets AJ, Varga J, et al. Efficient degradation of tannic acid by black Aspergillus species. Mycol Res. 2004; 108: 919-25.

6) Beverini M, Metche M. Identification, purification and physicochemical properties of tannase of Aspergillus oryzae. Sci Aliments. 1990; 10: 807-16.

7) Banerjee D, Mondai KC, Pati BR. Production and characterization of extracellular and intracellular tannase from newly isolated Aspergillus aculeatus DBF 9. J Basic Microbiol. 2001; 41: 313-8.

8) Iwashita K, Todoroki K, Kimura H, Shimoi H, Ito K. Purification and characterization of extracellular and cell wall bound β-glucosidases from Aspergillus kawachii. Biosci Biotechnol Biochem. 1998; 62: 1938-46.

9) Mukherjee G, Banerjee R. Biosynthesis of tannase and gallic acid from tannin rich substrates by Rhizopus oryzae and Aspergillus foetidus. J Basic Microbiol. 2000; 44: 42-8.

10) Mondai KC, Pati BR. Studies on the extracellular tannase from newly isolated Bacillus licheniformis KBR 6. J Basic Microbiol. 2000; 40: 223-32.

11) Niehaus JU, Gross GG. Purification and characterization of a gallotannin degrading esterase from leaves of pedunculate oak. Phytochemistry. 1997; 45: 1555-60.

12) Hatamoto O, Watarai T, Kikuchi M, Mizusawa K, Sekine H. Cloning and sequencing of the gene encoding tannase and structural study of the tannase subunit from Aspergillus oryzae. Gene. 1996; 175: 215-21.

13) Griffin DW, Kellogg CA, Peak KK, Shinn EA. A rapid and efficient assay for extracting DNA from fungi. Lett Appl Microbiol. 2002; 34: 210-4.

14) Böer E, Bode R, Mock HP, Piontek M, Kunze G. Atanlp-an extracellular tannase from the dimorphic yeast Arxula adeninivorans: molecular cloning of the ATAN1 gene and characterization of the recombinant enzyme. Yeast. 2009; 26: 323-37.

15) Iwamoto K, Tsuruta H, Nishitaini Y, Osawa R. Identification and cloning of a gene encoding tannase (tannin acylhydrolase) from Lactobacillus plantarum ATCC 14917(T). Syst Appl Microbiol. 2008; 31: 269-77.

16) Banerjee D, Mondai KC, Pati BR. Tannase production by Aspergillus aculeatus DBF9 through solid-state fermentation. Acta Microbiologica et Immunologi ca Hungarica. 2007; 54: 159-66.

17) Braumann I, van den Berg MA, Kempken F. Strain-specific retrotransposon-mediated recombination in commercially used Aspergillus niger strain. Mol Genet Genomics. 2008; 280: 319-25.

18) Mata-Gomez M, Rodriguez LV, Ramos EL, et al. A novel tannase from the xerophilic fungus Aspergillus niger GHl. J Microbiol Biotechnol. 2009; 19: 987-96.

19) Tonukari NJ, Scott-Craig JS, Walton JD. Isolation of the carbon catabolite repressor (CREA) gene from the plant-pathogenic fungus Cochliobolus carbonum. DNA Seq. 2003; 14: 103-7.

20) Tilburn J, Sarkar S, Widdick DA, et al. The Aspergillus PacC zinc finger transcription factor mediates regulation of both acid- and alkaline-expressed genes by ambient pH. EMBO J. 1995; 15:779-90.

21) Koseki T, Mihara K, Murayama T, Shiono Y. A novel Aspergillus oryzae esterase that hydrolyzes 4-hydroxybenzoic acid esters. FEBS Lett. 2010; 24: 4032-6.

22) Noguchi N, Ohashi T, Shiratori T, et al. Association of tannase-producing Staphylococcus lugdunensis with colon cancer and characterization of a novel tannase gene. J Gastroenterol. 2007; 42: 346-51.