Metabarcoding of the kombucha microbial community grown in different microenvironments

Abstract

Introducing of the DNA metabarcoding analysis of probiotic microbial communities allowed getting insight into their functioning and establishing a better control on safety and efficacy of the probiotic communities. In this work the kombucha poly-microbial probiotic community was analysed to study its flexibility under different growth conditions. Environmental DNA sequencing revealed a complex and flexible composition of the kombucha microbial culture (KMC) constituting more bacterial and fungal organisms in addition to those found by cultural method. The community comprised bacterial and yeast components including cultured and uncultivable microorganisms. Culturing the KMC under different conditions revealed the core part of the community which included acetobacteria of two genera Komagataeibacter (former Gluconacetobacter) and Gluconobacter, and representatives of several yeast genera among which Brettanomyces/Dekkera and Pichia (including former Issatchenkia) were dominant. Herbaspirillum spp. and Halomonas spp., which previously had not been described in KMC, were found to be minor but permanent members of the community. The community composition was dependent on the growth conditions. The bacterial component of KMC was relatively stable, but may include additional member--lactobacilli. The yeast species composition was significantly variable. High-throughput sequencing showed complexity and variability of KMC that may affect the quality of the probiotic drink. It was hypothesized that the kombucha core community might recruit some environmental bacteria, particularly lactobacilli, which potentially may contribute to the fermentative capacity of the probiotic drink. As many KMC-associated microorganisms cannot be cultured out of the community, a robust control for community composition should be provided by using DNA metabarcoding.

Revaet al. AMB Expr (2015) 5:35 DOI 10.1186/s13568-015-0124-5

ORIGINAL ARTICLE

Open Access

http://crossmark.crossref.org/dialog/?doi=10.1186/s13568-015-0124-5&domain=pdf

Web End = Metabarcoding ofthe kombucha microbial community grown indierent microenvironments

http://crossmark.crossref.org/dialog/?doi=10.1186/s13568-015-0124-5&domain=pdf

Web End = http://crossmark.crossref.org/dialog/?doi=10.1186/s13568-015-0124-5&domain=pdf

Web End = http://crossmark.crossref.org/dialog/?doi=10.1186/s13568-015-0124-5&domain=pdf

Web End = http://crossmark.crossref.org/dialog/?doi=10.1186/s13568-015-0124-5&domain=pdf

Web End = http://crossmark.crossref.org/dialog/?doi=10.1186/s13568-015-0124-5&domain=pdf

Web End = http://crossmark.crossref.org/dialog/?doi=10.1186/s13568-015-0124-5&domain=pdf

Web End = http://crossmark.crossref.org/dialog/?doi=10.1186/s13568-015-0124-5&domain=pdf

Web End = Oleg N Reva1*, Iryna E Zaets2, Leonid P Ovcharenko2, Olga E Kukharenko2, Switlana P Shpylova2, Olga V Podolich2, JeanPierre de Vera3 and Natalia O Kozyrovska2

Abstract

Introducing of the DNA metabarcoding analysis of probiotic microbial communities allowed getting insight into their functioning and establishing a better control on safety and efficacy of the probiotic communities. In this work the kombucha polymicrobial probiotic community was analysed to study its exibility under dierent growth conditions. Environmental DNA sequencing revealed a complex and exible composition of the kombucha microbial culture (KMC) constituting more bacterial and fungal organisms in addition to those found by cultural method. The commu nity comprised bacterial and yeast components including cultured and uncultivable microorganisms. Culturing the KMC under dierent conditions revealed the core part of the community which included acetobacteria of two genera Komagataeibacter (former Gluconacetobacter) and Gluconobacter, and representatives of several yeast genera among which Brettanomyces/Dekkera and Pichia (including former Issatchenkia) were dominant. Herbaspirillum spp. and Halomonas spp., which previously had not been described in KMC, were found to be minor but permanent members of the community. The community composition was dependent on the growth conditions. The bacterial component of KMC was relatively stable, but may include additional memberlactobacilli. The yeast species composition was sig nicantly variable. Highthroughput sequencing showed complexity and variability of KMC that may aect the quality of the probiotic drink. It was hypothesized that the kombucha core community might recruit some environmental bacteria, particularly lactobacilli, which potentially may contribute to the fermentative capacity of the probiotic drink. As many KMCassociated microorganisms cannot be cultured out of the community, a robust control for community composition should be provided by using DNA metabarcoding.

Keywords: Kombucha microbial community, Metabarcoding, Pyrosequencing

Introduction

Culture-dependent methods have revealed an enormous microbial diversity in various fermented products. However, there is still much to be discovered about development and functioning of microbial communities. The high-throughput sequencing technologies known also as next generation sequencing (NGS) are in use to examine the phylogenetic diversity, composition, and

dynamic structural changes in microbial communities of fermented foods, giving an opportunity to describe and predict relationships between species in these complex ecosystems (Kim et al. 2011; Oguntoyinbo and Narbad 2012; Park etal. 2012; Nam etal. 2012a, b; Illeghems etal. 2012; Marsh etal. 2014). Applicability of NGS for meta-barcoding and metagenomic analysis of environmental DNA samples allows identifying uncultured microbial species constituting the communities. Moreover, these approaches allow coupling of structural changes in the communities with environmental factorse.g., temperature, salinity, pH, etc.,to perform a meta-analysis of dynamic changes of microbiota (Shade et al. 2013). DNA metabarcoding of complex bacterial and fungal

*Correspondence: [email protected]

1 Bioinformatics and Computational Biology Unit, Department of Biochemistry, University of Pretoria, Lynnwood road, Hillcrest, Pretoria 0002, South AfricaFull list of author information is available at the end of the article

2015 Reva et al. This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/

Web End =http://creativecommons.org/licenses/by/4.0/ ), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made.

Revaet al. AMB Expr (2015) 5:35

Page 2 of 8

communities by proling of 16S rDNA sequences and internal transcribed regions (ITS) had opened new prospects in studying and designing of new efficient probiotics based on fermentation process.

Nowadays, when people became more concerned about obesity and prophylaxis chronic diseases, the probiotics and synbiotics have occupied an important sector within the functional food market. Most probiotic drinks are from dairy products. The tendency to veganism implied consuming of non-dairy nutraceuticals that called for design of new safe non-dairy probiotics, which became an essential health-keeping food category (Prado et al. 2008; Vasudha and Mishra 2013). Thus kombucha, in range with other fermented functional foods like kvass, fermented herb drinks, etc., may substitute dairy products for people with lactose intolerance (Gupta and Abu-Ghannam 2012). Fermented probiotic products are produced by complex microbial communities, which remain to be open environments characterized by rather unstable species composition dependent on nutritional sources and growth conditions.

Health improving eects of the kombucha probiotic beverage have been reported in a number of publications (Yapar et al. 2010; Bhattacharya et al. 2011, 2013; Aloulou etal. 2012; Kallel etal. 2012; Srihari etal. 2013). Kombucha microbial community (KMC) is an example of mutualistic metabolic cooperation of pro- and eukaryotic microorganisms (bacteria and yeasts). Several types of KMC are cultivated on dierent continents, which diered in the community structure and diversity (Teoh etal. 2004; Ovcharenko 2013; Marsh etal. 2014), but all of them always possessed cellulose-forming acetobacteria and yeasts. Close biochemical interplay between yeasts and bacteria was facilitated by enclosing the mixed community within cellulose-based pellicles created by the cellulose-producing bacteria on the surface of the liquid medium. The kombucha drink contains organic acids, amino acids, antibiotic substances, vitamins and also many other unidentied bioactive compounds benecial for human health (Jayabalan etal. 2010). Kombucha was proved to exert an antimicrobial activity against pathogens (Battikh etal. 2012). Because of a relative stability of the community and the benecial eect to human health, KCM was domesticated and widely spread around the world. It is usually cultivated in sweetened tea. Recently the kombucha and kombucha-like products with different supplements have been commercialized in many countries. It might be assumed that the KMC community is quite complex and many associated micro-organisms cannot be cultured out of the community. A robust control on the community composition might be provided by using NGS.

In this study, the microbial diversity of the kombucha variant from Ukraine (KMC-IMBG1) grown in dierent conditions was examined using both culture-dependent and culture-independent approaches. Study of a hybrid KMC-IMBG1 was performed to elucidate exibility of KMC and its ability to recruit organisms from other communities in a similar way as it was reported for kimchi where additives had inuenced the microbial community (Jung etal. 2011). Roche 454 pyrosequencing of amplied barcode sequences followed by a computer-based proling of microbial species have uncovered multiple uncultivable members of KMC-IMBG1 in the pellicles and cultural liquid. KMC composition was depending on the growth conditions and showed ability to recruit accessory members such as lactobacilli.

Materials andmethods

Microbial cultures andculturing conditions

The kombucha microbial culture was obtained from the collection of microorganisms of the Institute of Molecular Biology and Genetics of National Academy of Sciences (Kyiv, Ukraine). It was maintained in a lter sterilized black tea (Lipton, 1.2%, w/v) extract with sucrose (3.0%, w/v) (sBTS) or non-sterile BTS (nsBTS). KMC-IMBG1 also has been maintained in lter (0.22m, Millipore) sterilized black tea supplemented with honey (2.0%) (BTH). A matured KMC-IMBG1 was obtained after cultivation for 14days at 28C without shaking. A hybrid KMC was obtained by growing KMC-IMBG1 in fermented cabbage brine. More specically, the KMC cultural liquid (10%), which previously was pre-cultured in BTH, was added to the minced cabbage supplemented with honey (2.0%). The cultivation conditions were the same as described above. Newly formed pellicles were used for inoculation of fresh BTH in a weekly basis for 5 weeks. For isolation and cultivation of acetobacteria, HS agar medium (Hestrin and Schramm 1954) was used. The isolates were incubated for 37days at 30C under stationary conditions in HS until formation of pellicles. Yeast cultures were isolated on the Glucose Yeast Pep-tone agar medium (HiMedia Laboratories, India). Concomitant bacteria were screened on the minimal agar medium with sucrose (Miller 1972). For medium selectivity, the antibiotics cycloheximide (100 g/ml, Sigma-Aldrich) against yeast and ceftriaxone (50g/ml, Roshe) against bacteria were added to corresponding media.

Confocal scanning laser microscopy

After cultivation for 14days in sBTS, the bacterial cellulose-based pellicle samples were xed in formaldehyde vapor during 1 h and stained with calcouor (excitation 405 nm, lter BP 420480) and thiazine red dyes

Revaet al. AMB Expr (2015) 5:35

Page 3 of 8

(excitation 514nm, lter BP 530600nm). A microscopic examination of sample uorescence was performed, using CSLM AXIOSKOP-2 ZEISS equipped with the LSM 510 PASCAL (CarlZeiss, FRG) software.

DNA extraction

Total DNA samples from the kombucha liquid culture and pellicle were isolated for further barcode amplication and pyrosequencing. Microbial DNA isolation from the 14day-old KMC-IMBG1 liquid hybrid culture was performed with innuSPEED bacteria/fungi DNA isolation kit (Analytik Jena AG). In parallel, total DNA samples from cellulose-based hybrid kombucha pellicle (as well as the 14 day-old pellicles produced by KMCIMBG1 grown in sBTS, nsBTS, and BTH) were isolated from three specimens, using modied soft lyses method after blending of the pellicle (Gabor et al. 2003). The nucleic acids were quantied and qualied by a NanoDrop ND-1000 spectrophotometer (NanoDrop Technologies, Wilmington, DE).

PCR amplication, DNA sequencing andanalysis

Bacterial and yeast isolates from KMC-IMBG1 were identied by PCR amplication using standard primers 27F/1494R (AGAGTTTGATCCTGGCTCAG/TGACTG ACTGAGGYTACCTTGTTACGACTT) for bacterial 16SrDNA and NL1/NL4 (GCATATCAATAAGCGGAGG AAAAG/GGTCCGTGTTTCAAGACGG) for fungal 26S rDNA amplication as it was described previously (Ogino et al. 2001; Kurtzman and Robnett 1997). More specically, the PCR reactions for both primers were run for 35 cycles with annealing temperature 54C for 27F/1494R and 52C for NL1/NL4. PCR products were cleaned with UltraClean PCR Clean-up DNA purication kit (MoBio Laboratories). The PCR products were sequenced by the Sanger method (Sanger et al. 1977) using Big Dye Terminator Sequencing Standard Kit v3.1 (Applied Biosystems, USA) and apparatus 3130 Genetic Analyser (Applied Biosystems). The 16S rDNA sequences were binned by BLASTN search through the National Center for Biotechnology Information (NCBI) GenBank (US National Library of Medicine, Bethesda, Maryland, USA). These sequence data have been submitted to the GenBank database under an accession numbers KF908872-KF90879.

DNA pyrosequencing

DNA sequencing has been performed by using Roche GS FLX in Inqaba Biotec (http://www.inqababiotec.co.za

Web End =http://www.inqababiotec.co.za ). Pairs of standard primers 27F 5-AGAGTTTGATCC TGGCTCAG-3 (Lane 1991) and 518R 5ATTACC GCGGCTGCTGG-3 (Muyzer et al. 1993) for 16S; and ITS1 5-TCCGTAGGTGAACCTGCGG-3 and ITS4

5-TCCTCCGCTTATTGATATGC-3 (White etal. 1990) for ITS amplication were used. Generated 16S rRNA reads were checked for chimers by using DECIPHER algorithm (Wright et al. 2012) set for analysis of short-length sequences. In total 30 putative chimeras were identied and removed from the read datasets. Quality control was performed by locally installed Fast QC program (http://www.bioinformatics.babraham.ac.uk/projects/fastqc

Web End =http://www.bioinformatics.babraham.ac.uk/pro http://www.bioinformatics.babraham.ac.uk/projects/fastqc

Web End =jects/fastqc ). Poor quality reads with Phred quality score below 20 (that corresponded to p value 0.05) and reads shorter than 100bp were ltered out.

Metabarcoding dataset statistics

DNA reads obtained from the sequencer were aligned by the local BLASTN against combined NCBI 16S Microbial and GreenGenes16S databases for identification of 16S rDNA reads and against the NCBI nt-database for identification of ITS reads. The latest versions of GreenGene and NCBI databases available at the time of running of this analysis, i.e., the mid of 2014, were used in this study. The BLASTN results were merged and visualized by MEGAN 5.2.3 (Huson et al. 2011). Additionally, the BLASTN output files were searched by an in-house BioPython based script to retrieve the statistics of the top scored hits over all reads. A taxon presence in a sample was accepted, if there were at least five reads binned to this taxonomic unit. The minimum BLASTN score for taxon identification was 300. Statistics of pyrosequencing is shown in Table1.

Not ltered metabarcoding data sets were deposited in the Metagenomics RAST database server (4543580.3-4543590.3).

Expected species richness of a sample was estimated according to Chao 1 equation (Chao 1984):

where Sexpexpected species richness; Sobsobserved number of species; F1 is the number of singletons (i.e., the number of species with only a single occurrence in the sample) and F2 is the number of doubletons (the number of species with exactly two occurrences in the sample).

Rarecation curves were estimated by counting of number of identied species after successful binning of every 200 reads. An exception was the dataset ITS_sBTS when species number increment was measured every 100 successfully binned reads because of the small size of this dataset. The binning was considered as successful if the BLASTN score was 300.

Distance between two metabarcode datasets was measured by the Eq.2:

Sexp = Sobs +

F21

2F2

(1)

Revaet al. AMB Expr (2015) 5:35

Page 4 of 8

Table 1 DNA reads obtained by Roche 454 sequencing of dierent samples

Sample Total number of reads before and after ltering and chimera removal

Total length, bp Average Min. read lengtha

Max. read length

Sobs/Sexp

sBTS

Pellicle: 16S 2,384/2,356 1,123,074 471 77 607 14/46 Pellicle: ITS 532/530 277,232 521 61 568 5/10 BTHPellicle: 16S 2,632/2,626 1,244,214 472 47 828 14/46 Pellicle: ITS 7,888/7,783 3,303,150 418 43 561 23/87 nsBTSPellicle: 16S 1,880/1,828 870,798 463 65 563 24/33 Pellicle: ITS 3,741/2,310 1,138,925 304 41 536 7/23 Hybrid KMCPellicle: 16S 8,716/8,250 2,975,027 341 40 513 9/10 Pellicle: ITS 7,943/7,113 2,500,278 314 40 541 18/34 Liquid phase: 16S 6,494/6,325 2,294,949 353 40 513 16/17 Liquid phase: ITS 9,541/8,281 3,165,774 331 40 521 26/38

a All reads shorter than 100bp were ltered out.

Sobs observed number of species including those identied by a single read, Sexp expected number of species according to Chao estimation (Eq.1).

[notdef]

2

m1

N1 m2

N2

D =

Ncomb

(2)

where Ncombtotal number of identied species in both datasets; m1 and m2numbers of reads binned to the species m in the datasets 1 and 2, respectively; N1 and N2total numbers of binned reads in the datasets 1 and 2, respectively. Distances were used to infer dendrograms of dataset diversity by using the Neighborjoining algorithm implemented in MEGA6 (Tamura etal. 2013).

Results

Isolation ofcultivable forms ofmicroorganisms associated withKMC

DNA fragments amplied by PCR from DNA samples extracted from cultivable isolates of KMC-IMBG1 were binned to taxonomic units by BLASTN alignment. Members of four yeast genera Pichia, Brettanomyces/Dekkera, Candida and Zygosaccharomyces; and two bacterial genera Gluconacetobacter (now Komagataeibacter gen. nov., Yamada etal. 2012) and Gluconobacter were identied. On the species level there were Komagataeibacter sp. (99% homology to K. xylinus and K. saccharivorans), K. intermedius, K. kombuchae, and Gluconobacter oxydans. As it was revealed by culture methods, the simplest structure of KMC cultivated in sterile black tea with sugar (sBTS) composed of two yeast species of Pichia and Brettanomyces/Dekkera; and two acetobacteria: Komagataeibacter sp. and K. intermedius. In classic non-sterile sweetened black tea medium (nsBTS), KMC-IMBG1

comprised Pichia sp., Dekkera anomala, Candida sp., Komagataeibacter sp., K. intermedius and Gluconobacter oxydans. Additional yeast species Zygosaccharomyces bailii and acetobacterium K. kombuchae were isolated from the culture maintained in the sterile black tea medium with honey (BTH). In the hybrid kombucha culture grown in BTH mixed with cabbage brine, several atypical bacterial species have been identied including Bacillus subtilis, B. pumilis (Firmicutes) and Microbacterium sp. (Actinobacteria).

At the same time, the confocal scanning laser microscopy revealed a higher level of diversity of KMC-IMBG1 especially those associated with the cellulose 3D web (Additional le 1: Figure S1). It was hypothesized that uncultivable microbial organisms might be abundant in this network. Particularly, there were peculiar long cells observed during the dormancy state (Additional le 1: Figure S1b), which were dissimilar to any cultivable bacteria (Puspita et al. 2012). To overcome the problem of identication of uncultivable representatives of KMCIMBG1, a metabarcoding approach has been used.

Metabarcoding analysis ofKMCIMBG1 grown indierent conditions

According to the results of analysis of metabarcodes, the acetobacteria of Komagataeibacter and Gluconobacter genera (-Proteobacteria) dominated in KMCIMBG1 grown in sBTS, nsBTS and BTH with a few other bacterial species of Komagataeibacter. K. xylinus prevailed in all analysed bacteriomes (77.796.8%); K. intermedius reached up to 4.9%, and Gluconobacter

Ncomb

Revaet al. AMB Expr (2015) 5:35

Page 5 of 8

spp., most of which belonged to G. oxydans, composed up to 10% of bacterial community in BTH. However, when grown in nsBTS, the proportion of Gluconobacter decreased 50-folds (Figure1). This can be explained by the preferred consumption of dierent sugars present in honey (Mandal and Mandal 2011). Estimated richness of bacterial and fungal species of KMC is shown in Table 1. Interestingly, Gluconoacetobacter diazotrophicus known as an obligate sugarcane endophyte (Baldani etal. 1997) was constantly present in all variants of KMC studied in this work; however, this species was not isolated by culture-dependent method. Herbaspirillum spp. and Halomonas spp. were a minor, but permanent component in KMC-IMBG1 grown in all the dierent conditions. Presence of Halomonas sp. was also reported in kombucha microbiota revealed in the metabarcoding study by Shade (2011). The minor fractions of the KMC-IMBG1 were represented by several occasional Firmicutes, -and -Proteobacteria (see Figure1).

The metabarcoding showed that KMC-IMBG1 comprised yeast species belonging to Pichia, Brettanomyces/Dekkera, Candida and Saccharomyces genera, as well as unknown OTUs similar to compost fungus and unknown yeast. The yeast composition widely varied in dierent cultures. The major yeast species of KMCIMBG1 grown in sBTS was Dekkera anomala. Pichia fermentas was abundant in BTH, and Pichia occidentalis (former Issatchenkia occidentalis) was the most frequent

in nsBTS (Figure2). This observation suggested that the domination of that or another yeast species signicantly depended on the cultivation conditions at much higher extend than it was observed for the core bacterial community (see Figures 1, 2). It was remarkable that an uncultured unknown fungal species identied as compost fungus was the most abundant in BTH and to some extend in nsBTS.

Metabarcoding analysis ofthe hybrid kombucha culture

Bacterial and yeast communities of the hybrid KMCIMBG1 grown in a mixture of lter-sterilized BTH with added sweetened fermented cabbage brine were expectedly much more diverse (Figure 3). K. xylinus was a dominant bacterial species. Lactobacilli, which probably originated from the cabbage brine and remained here in series of passages, were abundant in the hybrid KMC-IMBG1 pellicles. Lactobacillus spp. isolates were reported before as indispensable kombucha community members (Marsh etal. 2014). Lactobacilli are known also as the indigenous inhabitants of fermented cabbage (Jung etal. 2011). L. plantarum causes fermentation of cabbage carbohydrates to the lactic acid or acetic acid.

Several bacterial OTUs failed with taxonomic affiliation because of lack of appropriate reference sequences in the searched databases (Figure3a). Yeast DNA barcoding discovered a much higher number of OTUs in pellicles

100

% Total tag sequences per sample

80

60

40

20

0

sBTS

BTH

nsBTS

Komagataeibacter xylinus

Gluconobacter oxydans

Komagataeibacter intermedius

Gluconoacetobacter

diazotrophicus

Gluconobacter sp.

Komagataeibacter nataicola

Gluconoacetobacter entanii

Herbaspirillum putei

Shewanella algae

Halomonas phoceae

Burkholderia sp.

Shewanella haliotis

Herbaspirillum sp.

Halomonas sp.

Other minor fractions

Figure1 Proles of bacterial species of KMCIMBG1 grown in sterile black tea with sugar (sBTS), nonsterile black tea with honey (BTH) and nonsterile black tea with sugar (nsBTS) identied by binning of 16S rDNA reads.

100

% Total tag sequences per sample

80

60

40

20

0

Dekkera anomala

andida sp.

sBTS

BTH

nsBTS

Uncultured compost fungus

Pichia occidentalis/ P.cecembensis

Pichia fermentans

Uncultured eukaryote

similar to clone FS2_2_02

Uncultured eukaryote

similar to clone FS1_78

Yarrowia lipolytica

Other minor fractions

Figure2 Proles of yeast species in KMCIMBG1 grown in sterile black tea with sugar (sBTS), sterile black tea with honey (BTH) and nonsterile black tea with sugar (nsBTS) identied by binning of ITS reads.

Revaet al. AMB Expr (2015) 5:35

Page 6 of 8

a

% Total tag sequences per sample

60

50

40

30

20

10

0

Komagataeibacter xylinus

Lactobacillus sp.

Gluconobacter oxydans

Gluconobacter sp.

Komagataeibacter intermedius

Unknown bacteria clone 1

Unknown bacteria clone 2

Phycisphaera mikurensis

Unknown similar to Bacillus firmus

Acetobacter estunensis

Komagataeibacter nataicola

Unknown similar to

A1 A2

Methylobacterium extorquens

Unknown similar to

Dorea formicigenerans

Other minor fractions

Acetobacter sp.

Unknown Pseudomonas stutzeri

Gluconoacetobacter diazotrophicus

Unknown similar to

b

% Total tag sequences per sample

60

50

40

30

20

10

0

Pichia occidentalis

Uncultured fungus clone 1

Saccharomycetales sp.

Candida zemplinina

Dekkera anomala

Uncultured fungus clone 2

Pichia hanoiensis

Uncultured Ascomycota

Uncultured fungus clone 3

Pichia sporocuriosa

Lecanicillium lecanii

Uncultured fungus clone 4

Candida stellimalicola

Uncultured Hypocreales

Pichia sp.

A1 A2

Uncultured compost fungus

UnculturedSaccharomycete

Dekkera bruxellensis

Uncultured fungus clone 5

Uncultured fungus clone 6

Other minor fractions

Figure3 Normalized abundance of the most frequent OTUs of KMC identied by BLASTN in a 16S rDNA and b ITS reads. A1liquid phase of the culture; A2cellulose based biolm. Numbers of identied reads were normalized by the total numbers of reads in the samples.

and cultural liquid in the hybrid kombucha culture as compared to the parental KMC-IMBG1. P. occidentalis/P. cecembensis were the dominant yeast species the same as in nsBTS (Figure3b). Many OTUs were not affiliated to any taxonomic units because of a weak sequence similarity, or they showed similarity to unknown microorganisms. Anyway, even the weak similarity was consistently against the same reference sequences that suggested that

the total number of species in KMC-IMBG1 was limited but many of them still remained unknown.

Comparative analysis ofmicrobiomes produced byKMC underdierent microenvironments

Rarecation curves for studied metabarcode datasets and dendrograms representing species diversity of KMC pellicle grown at dierent conditions are shown in Figure 4. Remarkably, fungal biomes of KMC varied to a much higher extend depending on the growth conditions than the bacterial component (see the scaling bars in dendrograms in Figure 4). The biggest number of bacterial OUTs, which were singletons or represented only by a few reads, was observed in KMC grown in non-sterile conditions (nsBTS). It is reected in the steepness of the corresponding rarecation curve in Figure 4. Interestingly, the richness of fungal species of the sample was depleted, that may be explained by presence of Bacillus and Pseudomonas, which might synthesize antifungal antibiotics. Nevertheless, the bacterial core component in nsBTS remained the same. The biggest alteration in the KMC bacteriome structure was observed in BTH (Figure4a) caused probably by honey addition. Microbial composition of the hybrid KMC including both the bacterial and fungal components showed a higher level of stability as the rarecation curves calculated for this community has got faster the saturation level (Figure4c, d).

Discussion

This study showed that KMC-IMBG1 is quite exible and variable community. The main highlight of this study was that KMC-IMBG1 grown on dierent sterile and non-sterile media produced a stable core microbiome comprising acetobacteria and few associated strains of yeast species, and a number of accessory species, which may or may not occur at dierent conditions. The core part of KMC-IMBG1 probably is critical for functioning of the whole community and might be responsible for recovery of the community after disturbance. In addition to prevalent community members, several minor but permanently occurring bacterial species of KMC-IMBG1 were also discovered. Among them there were Herbaspirillum spp. and Halomonas spp. These organisms were identied by binning the DNA reads originated from KMC grown in sterile and non-sterile media. In other studies on species composition of kombucha from North American and Ireland ecotypes these species were not reported (Marsh etal. 2014). Another disagreement with the report by Marsh etal. (2014) was that according to these authors the highest diversity of micro-ora was associated with the cellulose pellicle. In Figure4c, d it is seen in rarecation curves of the hybrid

Revaet al. AMB Expr (2015) 5:35

Page 7 of 8

16S rRNA based metagenomics ITS based metagenomics

0

sBTS

BTH sBTS nsBTS

Hybrid KMC (pellicle)

nsBTS Hybrid KMC (pellicle)

BTH

0.02

a b

0.002

30

0 0 1000 2000 3000 4000 5000 6000 0 500 1000 1500 2000 2500 3000 3500 4000

30

25

25

Number of OTU

20

Number of OTU

20

15

15

10

10

5

5

Number of binned reads

Number of binned reads

Hybrid KMC (liquid) Hybrid KMC (pellicle) sBTS BTH nsBTS

c d

Figure4 Statistical analysis of metabarcode datasets based on 16S rDNA (parts a and c) and ITS (pats b and d) amplicons. Dendrograms in a and b of diversity of datasets were built by neighborjoining algorithm based on distance tables calculated by Eq. 2. Parts c and d represent rarecation curves.

KMC-IMBG1 that both fungal and bacterial micro-ora of pellicle was more stable and less rich in dierent species than that from the liquid phase. Further research is needed to uncover the role of the core and accessory members of KMC, including the uncultivable bacteria, and how they contribute to stabilizing the community and gaining its biologically active. The ability to modify KMC is of practical importance as a possible approach to improve the medicinal and biotechnological properties of the kombucha products (Kozyrovska etal. 2012). This work is the promising rst step to design efficient and safe probiotics and synbiotics based on synthetic KMC communities of benecial and harmless microbial species. It was hypothesized that the positive activity of kombucha probiotic on human health may be improved and extended by domestication in the kombucha of other probiotic bacteria, e.g., lactobacilli, which in the current study most likely were recruited by KMC from the cabbage brine. There is still much to be discovered about bacteria-yeast communal interrelationships and their impact on the human microbiota. It also may be concluded that the DNA metabarcoding based on NGS is the best choice for proling of complex microbial communities of fermented products.

Additional les

Additional le 1: Figure S1. Confocal scanning laser microscopy images of a cross section of cellulosebased pellicle produced by KMCin a sugared black tea, showing a variety of both bacteria and yeast cell morphotypes (a); cells of unusual morphology (a long shape), which may indicate the existence of dormant uncultivable microbial (sub)popula tions (b). Cellulose and yeast cells stained with calcouor (a blue signal), bacterial cells and proteins stained with thiazine red (a yellow signal). Scale bar is 10 m.

Abbreviations

KMC: kombucha microbial community; KMCIMBG1: kombucha microbial community variant from Ukrainian collection; NGS: next generation sequenc ing; ITS: internal transcribed spacer; sBTS: kombucha culture grown on sterile black tea with sucrose; nsBTS: kombucha culture grown on nonsterile black tea with sucrose; BTH: kombucha culture grown on sterile black tea with honey.

Authors contributions

RO performed the bioinformatics analysis and helped to draft the manuscript; ZI coordinated the study, helped to draft the manuscript and designed gures; OL carried out the molecular genetic studies; KO isolated bacterial and yeast strains from the kombucha culture; SS carried out the CSLM observations; PO performed the sequence alignment; VJP partici pated in the design of the study; KN conceived the study, participated in its design, drafted the manuscript. All authors read and approved the nal manuscript.

Revaet al. AMB Expr (2015) 5:35

Page 8 of 8

Author details

1 Bioinformatics and Computational Biology Unit, Department of Biochemistry, University of Pretoria, Lynnwood road, Hillcrest, Pretoria 0002, South Africa.

2 Institute of Molecular Biology and Genetics of National Academy of Sciences of Ukraine, Acad. Zabolotnoho str., 150, Kiev 03680, Ukraine. 3 Institute of Plan etary Science, DLR, Rutherfordstr. 2, 12489 Berlin, Germany.

Acknowledgements

We thank Dr. Olha Yaneva (Institute of Microbiology and Virology of National Academy of Sciences, Kyiv) for consultations in yeast isolation and culturing. This study has been partially supported by the grant of National Academy of Sciences of Ukraine (N47/2013).

Compliance with ethical guidelines

Competing interests

The authors declare that they have no competing interests.

Received: 26 May 2015 Accepted: 28 May 2015

References

Aloulou A, Hamden K, Elloumi D, Ali MB, Harga K, Jaouadi B et al (2012)

Hypoglycemic and antilipidemic properties of kombucha tea in alloxan induced diabetic rats. BMC Complement Alternat Med 16:1263Baldani JI, Caruso L, Baldani VLD, Goi SR, Dbereiner J (1997) Recent advances in BNF with nonlegume plants. Soil Biol Biochem 29:911922Battikh H, Bakhrouf A, Ammar E (2012) Antimicrobial eect of kombucha analogues. LWT Food Sci Technol 47:7177Bhattacharya S, Manna P, Gachhui R, Sil PC (2011) Protective eect of kombu cha tea against tertiary butyl hydroperoxide induced cytotoxicity and cell death in murine hepatocytes. Indian J Exp Biol 49:511524 Bhattacharya S, Gachhui R, Sil PC (2013) Eect of kombucha, a fermented black tea in attenuating oxidative stress mediated tissue damage in alloxan induced diabetic rats. Food Chemical Toxicol 60:328340Chao A (1984) Nonparametric estimation of the number of classes in a popu lation. Scand J Stat 11:265270Gabor EM, de Vries EJ, Janssen DB (2003) Efficient recovery of environmental

DNA for expression cloning by indirect extraction methods. FEMS Micro biol Ecol 44:153163Gupta S, AbuGhannam N (2012) Probiotic fermentation of plant based prod ucts: possibilities and opportunities. Crit Rev Food Sci Nutr 52:183199 Hestrin S, Schramm M (1954) Synthesis of cellulose by Acetobacter xylinum 2 preparation of freezedried cells capable of polymerizing glucose to cel lulose. Biochem J 58:345352Huson DH, Mitra S, Ruscheweyh HJ, Weber N, Schuster SC (2011) Integrative analysis of environmental sequences using MEGAN4. Genome Res 21:15521560Illeghems K, De Vuyst L, Papalexandratou Z, Weckx S (2012) Phylogenetic analysis of a spontaneous cocoa bean fermentation metagenome reveals new insights into its bacterial and fungal community diversity. PLoS One 7:e38040Jayabalan R, Malini K, Sathishkumar M, Swaminathan K, Yun SE (2010)

Biochemical characteristics of tea fungus produced during kombucha fermentation. Food Sci Biotechnol 19:843847Jung J, Lee SH, Kim JM, Park MS, Bae JW, Hahn Y et al (2011) Metagenomic analysis of kimchi, a traditional Korean fermented food. Appl Environ Microbiol 77:22642274Kallel L, Desseaux V, Hamdi M, Stocker P, Ajandouz EH (2012) Insights into the fermentation biochemistry of kombucha teas and potential impacts of kombucha drinking on starch digestion. Food Res Internat 49:226232 Kim YS, Kim MC, Kwon SW, Kim SJ, Park IC, Ka JO et al (2011) Analyses of bacterial communities in meju, a Korean traditional fermented soybean bricks, by cultivationbased and pyrosequencing methods. J Microbiol 49:340348Kozyrovska N, Reva O, Goginyan V, de Vera JP (2012) Kombucha microbiome as a probiotic: a view from the perspective of postgenomics and syn thetic ecology. Biopolym Cell 28:103110

Kurtzman CP, Robnett CJ (1997) Identication of clinically important ascomy cetous yeasts based on nucleotide divergence in the 5 end of the large subunit (26S) ribosomal DNA gene. J Clin Microbiol 35:12161223

Lane DJ (1991) 16S/23S rRNA sequencing. In: Stackebrandt E, Goodfellow M

(eds) Nucleic acid techniques in bacterial systematics. Wiley, New York,pp 115175Mandal MD, Mandal S (2011) Honey: its medicinal property and antibacterial activity. Asian Pac J Trop Biomed 1:154160Marsh AJ, OSullivan O, Hill C, Ross RP, Cotter PD (2014) Sequencebased analysis of the bacterial and fungal compositions of multiple kombucha (tea fungus) samples. Food Microbiol 38:171178Miller JH (1972) Experiments in molecular genetics. Cold Spring Harbor Labo ratory, Cold Spring Harbor, p 436Muyzer G, De Waal EC, Uitterlinden AG (1993) Proling of complex microbial populations by denaturing gradient gel electrophoresis analysis of polymerase chain reactionamplied genes coding for 16S rRNA. Appl Environ Microbiol 59:695700Nam YD, Lee SY, Lim SI (2012a) Microbial community analysis of Korean soybean pastes by nextgeneration sequencing. Int J Food Microbiol 155:3642Nam YD, Park SL, Lim SI (2012b) Microbial composition of the Korean tradi tional food kochujang analyzed by a massive sequencing technique. J Food Sci 77:250256Ogino A, Koshikawa H, Nakahara T, Uchiyama H (2001) Succession of microbial communities during a biostimulation process as evaluated by DGGE and clone library analyses. J Appl Microbiol 91:625635Oguntoyinbo FA, Narbad A (2012) Molecular characterization of lactic acid bacteria and in situ amylase expression during traditional fermentation of cereal foods. Food Microbiol 31:254262Ovcharenko LP (2013) Metagenomic analysis of domesticated kombucha multimicrobial culture. Biopolym Cell 29 (special issue: p 16)

Park EJ, Chun J, Cha C, Park WC, Jeon C, Bae JW (2012) Bacterial community analysis during fermentation of ten representative kinds of kimchi with barcoded pyrosequencing. Food Microbiol 30:197204Prado FC, Parada J, Pandey A, Soccol CR (2008) Trends in nondairy probiotic beverages. Food Res Int 41:111123Puspita ID, Kamagata Y, Tanaka M, Asano K, Nakatsu CH (2012) Are uncultivated bacteria really uncultivable? Microb Environ 27:356366Sanger F, Nicklen S, Coulson AR (1977) DNA sequencing with chainterminat ing inhibitors. Proc Natl Acad Sci USA 74:54635467Shade A (2011) The kombucha biolm: a model system for microbial ecology.

In: Final report on research conducted during the Microbial Diversity course. Marine Biological Laboratories, Woods Hole, MAShade A, Caporaso G, Handelsman J, Knight R, Fierer N (2013) A metaanalysis of changes in bacterial and archaeal communities with time. ISME J 7:14931506Srihari T, Karthikesan K, Ashokkumar N, Satyanarayana U (2013) Antihyper glycaemic efficacy of kombucha in streptozotocininduced rats. J Funct Foods 5:17941802Tamura K, Stecher G, Peterson D, Filipski A, Kumar S (2013) MEGA6: molecular evolutionary genetics analysis version 6.0. Mol Biol Evol 30:27252729 Teoh AL, Heard G, Cox J (2004) Yeast ecology of kombucha fermentation. Int J

Food Microbiol 95(2):119126Vasudha S, Mishra HN (2013) Nondairy probiotic beverages. Int Food Res J

20:715White TJ, Bruns T, Lee S, Taylor J (1990) Amplication and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis MA, Gelfand DH, Sninsky JJ, White TJ (eds) PCR protocols: a guide to methods and applica tions. Academic Press, New York, pp 315322Wright ES, Yilmaz LS, Noguera DR (2012) DECIPHER, a searchbased approach to chimera identication for 16S rRNA sequences. Appl Environ Microbiol 78:717725Yamada Y, Yukphan P, Lan Vu HT, MuramatsuY Ochaikul D, Tanasupawat S et al

(2012) Description of Komagataeibacter gen nov with proposals of new combinations (Acetobacteraceae). J Gen Appl Microbiol 58:397404 Yapar K, Cavusoglu K, Oruc E, Yalcin E (2010) Protective eect of kombucha mushroom (KM) tea on phenolinduced cytotoxicity in albino mice. J Environ Biol 31:615621