About the Authors:
Ezequiel Názer
Affiliation: Instituto de Investigaciones Biotecnológicas-Instituto Tecnológico Chascomús, UNSAM-CONICET, San Martín, Provincia de Buenos Aires, Argentina
Daniel O. Sánchez
* E-mail: [email protected]
Affiliation: Instituto de Investigaciones Biotecnológicas-Instituto Tecnológico Chascomús, UNSAM-CONICET, San Martín, Provincia de Buenos Aires, Argentina
Introduction
Trypanosomes are protozoan parasites with sanitary relevance, since many members of this group of parasites are causative agents of important and neglected human diseases, such as Chagas disease in America and Sleeping sickness disease in Africa [1]. In addition to their potential impact in human health, trypanosomes are attractive model organisms to study fundamental processes such as RNA metabolism and processing. For instance, in contrast to most eukaryotes, trypanosomes do not regulate mRNA synthesis at the transcriptional level [2], [3]. Gene expression regulation in these organisms is mostly achieved post-transcriptionally by controlling mRNA stability and translation [2], [4].
Trypanosomes are also characterized by having complex life cycles alternating between vertebrate and invertebrate hosts, where they are exposed to different stress conditions that change abruptly [5], [6]; therefore, several and rapid modifications at the gene expression level must be accomplished in order to readapt to such different conditions and niches [7]. In this regard, the rapid formation of stress granules in response to starvation and severe heat shock [8], [9], as well as the relocalization of certain of RNA Binding Proteins (RBPs) and poly(A)+ RNA to the nucleolus induced by particular stress conditions [10], might add another layer of rapid post-transcriptional regulation in these organisms.
The nucleolus is a subnuclear structure which has been traditionally seen as the ribosomes “factory”. More recently, it has been shown that it also plays additional functions related to other cellular processes [11]. Among its novel functions, it has been proposed that it might act as a sensor and coordinator of the stress response [12], [13]. In this respect, there is a growing number of reports showing that key factors are sequestered in the nucleolus during certain stress conditions [14]–[19]. Interestingly, both the Arabidopsis and human nucleolar proteomes have shown the unexpected nucleolar localization of RBPs involved in different steps of mRNA metabolism [20]–[22]. In T. cruzi, we have recently shown that some RBPs are accumulated into the nucleolus in response to Actinomycin D (ActD) treatment, suggesting a novel potential role of the trypanosome nucleolus in gene expression regulation mechanisms [10]. In this regard, an interesting possibility might be that the nucleolus, in response to certain stress conditions, could sequester RBPs involved in mRNA metabolism in order to modulate the gene expression repertoire.
The aim of this work was to evaluate whether such nucleolar accumulation of RBPs is also functional in other members of the trypanosomatid family. In agreement with our previous results in T. cruzi, this mechanism is also conserved in L. mexicana. In contrast, in T. brucei, neither endogenous RBPs nor a transgenic RBP from T. cruzi were relocated into the nucleolus in response to ActD. Together, our results suggest that the mechanism behind the nucleolar relocalization of RBPs in trypanosomes seems to be lost or retained differentially during the evolution of the trypanosomatid lineage.
Results
Behaviour of RBPs in L. mexicana and T. brucei in response to ActD treatment
To know whether the mechanism responsible for the nucleolar relocalization of RBPs induced by ActD in T. cruzi was also conserved in other trypanosomatids, we evaluated the behaviour of the RBP LmxPABP2 (LmxM.34.4130) in L. mexicana promastigotes. The Poly(A)-Binding Protein (PABP) of eukaryotes is a cytoplasmic RBP implicated in different steps of mRNA metabolism [23], [24]. Under normal conditions, LmxPABP2 was exclusively located in the cytoplasm (Figure 1A and S1A, top panels). However, when parasites were subjected to ActD, a transcriptional inhibitor which has extensively been used in several organisms, including trypanosomatids [25], [26], for 24 h, LmxPABP2 was accumulated into the nucleolus in 63% of parasites, since it colocalized with the weakest area of staining with the DNA-specific dye DAPI and with the nucleolar antigen L1C6. It should be mentioned that in most of the parasite population (around 90%), the L1C6 marker was dispersed from the nucleolus to the nucleoplasm after ActD treatment. Therefore, as previously done for T. cruzi [10], we used the remaining parasites for colocalization studies. This result is in agreement with the behaviour of the PABP2 orthologue in T. cruzi (TcPABP2) [10], suggesting that the mechanism of RBP nucleolar relocalization is also present in L. mexicana. To further support this conclusion, we expressed the T. cruzi RBP TcPTB2 (Tc00.1047053511727.160), as a C-terminal eGFP fusion protein, in L. mexicana. In concordance with its behaviour in T. cruzi [10], the TcPTB2 transgenic protein was also accumulated into the nucleolus in response to ActD treatment in a L. mexicana context (Figure 1B, bottom panels).
[Figure omitted. See PDF.]
Figure 1. Behaviour of RBPs in L. mexicana and T. brucei in response to ActD treatment.
(A) Immunofluorescence images for endogenous LmxPABP2 in L. mexicana in control or ActD-treated parasites for 24 h. LmxPABP2 (green) was colocalized with the nucleolar marker L1C6 (red) and DAPI. (B) Images of TcPTB2-eGFP (green), DAPI and L1C6 are shown in ActD-treated (24 h) and untreated parasites. (C) Immunofluorescence images for endogenous TbRRM1 and (D) TbPABP2 in T. brucei in control, after 4 h or 24 h of ActD treatment. TbRRM1 (green) was colocalized with the nucleolar marker L1C6 (red) and DAPI, whereas TbPABP2 (green) was colocalized with TbRRM1 (red) and DAPI. Nuclei were counterstained with DAPI (blue). The forth column on the right is an overlap of each protein analyzed and DAPI. The quantification for LmxPABP2 is expressed as the mean from at least three independent experiments. N: nucleus, Nu: nucleolus. Size bars represent 2 µm. Representative nuclei are shown.
https://doi.org/10.1371/journal.pone.0024184.g001
We then extended our study to T. brucei procyclic forms, by exploring the behaviour of two RBPs, namely TbRRM1 (Tb927.2.4710) [27] and TbPABP2 (Tb09.211.2150) [28]. Under normal conditions, TbRRM1 was localized throughout the nucleoplasm, presenting a speckled pattern (Figure 1C and S1B, top panels). On the other hand, TbPABP2 exhibited a predominantly cytoplasmic distribution (Figure 1D and S1B, top panels). Both results are in agreement with previous reports [8], [27]. When parasites were treated with ActD for 4 h, the nucleolar marker became dispersed throughout the nucleoplasm in most cells, as previously shown in T. cruzi [10]. Interestingly, TbRRM1 remained in speckles, but being these larger and more rounded, whereas TbPABP2 remained in the cytoplasm (Figure 1C and 1D middle panels, and S1B). As this result was quite unexpected, we repeated the experiment treating the parasites for 24 h, and obtained a similar pattern (Figure 1C and 1D, bottom panels).
These results suggest that the mechanism involved in the nucleolar accumulation of RBPs in response to ActD described in T. cruzi [10] is also conserved in L. mexicana, but might be absent in T. brucei.
Transgene expression analysis demonstrated that the pathway/mechanism involved in nucleolar relocalization of RBPs is absent in T. brucei
As shown previously in T. cruzi [10], the RBPs TcSR62 (Tc00.1047053511621.50) and TcPABP2 (Tc00.1047053508461.140) were mobilized to the nucleolus in response to ActD treatment. The unexpected results that their orthologues in T. brucei (TbRRM1 and TbPABP2, respectively) did not accumulate into the nucleolus in response to this treatment (Figure 1C and D) might be explained in at least two possible ways: i) both orthologues in T. brucei lack functional nucleolar signals, which seems quite unlikely, in fact, sequence alignment analysis between TcSR62 and TbRRM1 showed that the same structural domains and sequence elements are present in both proteins (Figure S2); or ii) the mechanism/pathway behind nucleolar relocalization of RBPs is not operational in T. brucei. If the latter hypothesis is correct, we would then expect that TcSR62, expressed in this parasite, could not be accumulated into the nucleolus in response to ActD treatment. To test this, we expressed a TcSR62 transgene in T. brucei procyclic parasites using a Tetracycline (Tet)-inducible vector. We first confirmed the expression of TcSR62 by Western blot (Figure 2A) and then analyzed its behaviour under ActD treatment by immunofluorescence. In non-induced parasites, the antiserum against TcSR62 barely detected the endogenous TbRRM1 (Figure 2B, panel 1). However, after 24 h of Tet-induction, TcSR62 was detected mainly in nuclear speckled-like structures (Figure 2B, panel 2), being excluded from the nucleolus. When parasites were induced with Tet for 24 h and then subjected to ActD treatment for 4 h (Figure 2B, panel 3), instead of showing nucleolar accumulation, TcSR62 remained in more rounded speckles, which appeared coalesced all over the nucleus, displaying a pattern similar to that of TbRRM1 (compare with Figure 1C). Similar results were observed after 24 h of ActD treatment (Figure 2B, panel 4). As this result suggested that the mechanism was not operational in T. brucei, we then thought that TbRRM1 should be able to mobilize to the nucleolus if expressed in a T. cruzi background. To test this idea, we expressed a transgenic TbRRM1 as a C-terminal eGFP fusion protein using the pTEX vector [29]. Under normal conditions, it showed a nuclear speckled-like pattern as in T. brucei (Figure 2C, top panels). However, when parasites were subjected to ActD, TbRRM1 was accumulated into the nucleolus in 46% of epimastigote parasites (Figure 2C, bottom panels).
[Figure omitted. See PDF.]
Figure 2. Transgene expression analysis of TcSR62 in T. brucei and TbRRM1 in T. cruzi demonstrated that the pathway/mechanism involved in nucleolar relocalization of RBPs is absent in T. brucei.
(A) Western blot showing expression of TcSR62 in T. brucei after 24 h of induction with Tet 1 µg/ml in parasites untreated or subjected to ActD for 4 h. TbPABP2 was included as loading control. (B) Immunofluorescence images for TcSR62 expressed (green) in T. brucei after 24 h of Tet-induction subjected or not to ActD for 4 h or 24 h. The third column on the right represents an overlap of TcSR62 and DAPI. (C) Images for TbRRM1 (green) expressed as an eGFP-fusion in T. cruzi using a pTEX vector and colocalized with the nucleolar marker L1C6 (red) either before or after incubating the parasites with ActD for 24 h. The third column on the right is an overlap of TbRRM1-eGFP, L1C6 and DAPI. Nuclei were counterstained with DAPI (blue). The quantification for TbRRM1-eGFP is expressed as the mean from at least three independent experiments. N: nucleus, K: kinetoplast, Nu: nucleolus. Size bars represent 2 µm. Representative nuclei are shown.
https://doi.org/10.1371/journal.pone.0024184.g002
The mobilization of TbRRM1 to the nucleolus when expressed in T. cruzi clearly shows that TbRRM1 contains the necessary sequence elements to be targeted to the nucleolus. On the other hand, the lack of TcSR62 nucleolar transport in T. brucei reinforces our initial idea that the mechanism/pathway that transports RBPs to the nucleolus is missing in T. brucei.
Discussion
Recently, the resolution of nucleolar proteomes in several organisms has provided insights into the role of the nucleolus in numerous cellular processes [20]–[22]. For instance, these projects have unexpectedly shown the nucleolar presence of RBPs required in different steps of mRNA metabolism. In this frame, we have recently found in T. cruzi that a subset of RBPs, involved in mRNA metabolism, is accumulated into the nucleolus in response to ActD treatment [10]. These results, prompted us to evaluate whether this mechanism/pathway could also be present in other members of the trypanosomatid lineage. Interestingly, we found that the RBP LmxPABP2 from L. mexicana and a transgenic RBP from T. cruzi (TcPTB2) are accumulated into the nucleolus in response to long-term ActD treatment (Figure 1A, B and S1A), suggesting that this mechanism is also present in other trypanosomatids. However, a different picture was seen in T. brucei. In this parasite, we focused our studies on two RBPs related to the mRNA metabolism: a nuclear one (TbRRM1) and a cytoplasmic one (TbPABP2). To our surprise, neither protein was relocalized to the nucleolus when the parasites were incubated in the presence of ActD, even when incubated for 24 h. In fact, TbRRM1 behaved more similarly to SR proteins from plants or mammals, being accumulated in more rounded nuclear speckles-like structures [30]–[32]. The presence of nucleolar accumulation of RBPs in T. cruzi and L. mexicana but not in T. brucei was unexpected, since these parasites belong to the trypanosomatid family. Nevertheless, it should be noted that among these organisms, significant differences in molecular mechanisms have also been found, being the RNAi mechanism the most remarkable case [33]. This post-transcriptional mechanism, which is well conserved through the evolution of eukaryotes, including T. brucei, is nonfunctional in both T. cruzi and L. mexicana [34], [35].
To further demonstrate that the mechanism behind nucleolar relocalization of RBPs might be absent in T. brucei, we expressed TcSR62 (from T. cruzi) in T. brucei parasites and vice versa, TbRRM1 (from T. brucei) in T. cruzi epimastigotes (it is worth mentioning that both proteins are orthologues). As expected, TcSR62 did not accumulate into the T. brucei nucleolus in response to ActD, behaving as the endogenous TbRRM1 (Figure 2B). On the other hand, TbRRM1 was able to relocate to the nucleolus of T. cruzi under the same treatment (Figure 2C), suggesting that molecular determinants for nucleolar translocation are present in its sequence. Taken together, all these results strongly suggest that the mechanism involved in the nucleolar relocalization of RBPs is absent in T. brucei. One plausible explanation is that T. brucei has lost one or more key unidentified components which might be required to allow nucleolar relocalization of RBPs. This possibility has a precedent, since, as it has been previously reported, neither AGO1 homologues nor any other gene required to elicit the RNAi mechanism are present in T. cruzi and L. mexicana, where this pathway has been lost [33]–[35].
Finally, our results suggest that the mechanism driving RBPs nucleolar relocalization seems to have been lost/retained by different members of the trypanosomatid family during the evolution of this particular group of organisms.
Materials and Methods
Trypanosomes and reagents
T. cruzi CL Brener epimastigotes were cultured in BHT medium containing brain heart infusion, 0.3% tryptose, 0.002% bovine hemin and 10% heat-inactivated fetal calf serum (BHT 10%). L. mexicana promastigotes (Costa Rica strain) were cultured in BHT 20%. T. brucei procyclic parasites (29–13 strain) were cultured in SDM79 medium supplemented with 10% heat-inactivated fetal calf serum, 50 µg/ml of hygromycin B and 15 µg/ml of geneticin. T. brucei parasites expressing TcSR62 were also supplemented with 3 µg/ml of phleomycin. Inductions were performed incubating transfected parasites with 1 µg/ml of Tet for 24 h. Parasite cultures were taken in a late logarithmic growth phase at a cell density of 2.5–3.5×107/ml parasites for T. cruzi and L. mexicana and 0.5×107/ml parasites for T. brucei.
T. cruzi and L. mexicana were treated with ActD for 24 h. T. brucei parasites were incubated with ActD either for 4 h or 24 h. ActD was used at a final concentration of 50 µg/ml (Sigma).
Protein Extract
For total extract preparation, parasites were resuspended in lysis buffer (10 mM Tris-HCl (pH 7.6), 150 mM NaCl, 1 mM, 50 µM E64 (trans-epoxy succinyl amido (4-guanidino), phenylmethylsulfonyl fluoride, 1 mM and 0.5% Nonidet P-40) and incubated on ice for 15 min and then mixed with one volume of reducing cracking buffer 2×.
Western Blotting
Western blot was performed as recently described [10]. The primary antibodies used were polyclonal anti-TcSR62 (1∶1000) and polyclonal anti-TcPABP2 (1∶1000). The secondary antibody used was horseradish peroxidase-conjugated goat (1∶4000), developed with the Supersignal® West Pico Chemiluminescent Substrate (Pierce) according to the manufacturer's instructions.
Immunofluorescence
Immunofluorescences were performed as recently described [10]. The primary antibodies were monoclonal (L1C6, 1∶200), polyclonal anti-TcSR62 (1∶6000), polyclonal anti-TcPABP2 (1∶1000) and polyclonal anti-TbRRM1 (1∶1000). Secondary goat anti-rabbit or anti-mouse antibodies AlexaFluor 488 or AlexaFluor 594 (Molecular Probes) were used at 1∶1000 dilutions. Finally, cells were mounted in 1 µg/ml DAPI prepared in Fluorsave (Calbiochem). Analysis of subcellular localization was performed in a Nikon Eclipse E600 microscope coupled to a SPOT RT colour camera (Diagnostic Instruments). Merged images were obtained by superimposing the indicated image files in SPOT Software 4.0.9 (Diagnostic Instruments).
GFP fusion construct
Full-length TbRRM1 and TcPTB2 were amplified by PCR using the primers listed below and cloned, the former into the BamHI site and the latter into the EcoRI and HindIII sites of pTEX-eGFP kindly provided by Dr. J.M. Kelly [29].
TbRRM1
UTbRRM1_BamHI: GGATCCATGCAACAATATACCCTTCG
Rv_TbRRM1_NoSTOP_BamHI: CGGGATCCCGGTCCCTTACGCGGTC
TcPTB2
PTB_exp1: CCGAATTCATGATGTCCGTGGTCTTGC
Rv_PTB_NoSTOP_HindIII: AAGCTTCCCTCCTCTTCAGTTGGT
Parasite Transfections
T. cruzi transfections were carried out as recently described [10]. For L. mexicana, transfections were carried out with a BTX 600 electroporator in a 4-mm gap cuvette. A total of 100×106 parasites were harvested, washed twice in cold PBS, once in cold electroporation buffer (137 mM NaCl, 20 mM HEPES, 6 mM glucose, 5 mM KCl, 0.7 mM NaH2PO4) and resuspended in 0.4 ml of electroporation buffer with 50 µg of supercoiled plasmid DNA. The electroporation setting was: 1400 microfarads, 335 V, and 24 Ω. Parasites were recovered in 10 ml of BHT supplemented with 20% fetal calf serum (Natocor) and 36 h later geneticin (Sigma) was added at a final concentration of 50 µg/ml.
Supporting Information
[Figure omitted. See PDF.]
Figure S1.
Effects of ActD treatment on the localization of PABP2 and TbRRM1 showing whole parasites. Immunofluorescence images of the corresponding protein in ActD-treated and untreated parasites. (A) LmxPABP2 (green) was colocalized with the nucleolar marker L1C6 (red) in L. mexicana. Nuclei were counterstained with DAPI (blue). (B) Immunofluorescence images for TbRRM1 (green) and TbPABP2 (red) in T. brucei. Size bars represent 2 µm. Representative parasites are shown.
https://doi.org/10.1371/journal.pone.0024184.s001
(TIF)
Figure S2.
Sequence alignment between TbRRM1 and TcSR62. The RRMs (black), zinc finger (red), arginine rich (brown) and RS (pink) domains as well as the NLS (blue) element are indicated. The numeration is referred to TbRRM1. Within aligned regions, identical amino acids are shown in red letters over yellow background, while similar amino acids are shown with a green background. When necessary, spaces were inserted within the sequences to allow better alignment (indicated with slash lines). Sequence alignment analysis was performed by using Vector NTI software, whereas domains were assigned by using the Prosite database.
https://doi.org/10.1371/journal.pone.0024184.s002
(TIF)
Acknowledgments
We thank Agustina Chidichimo, Berta Franke de Cazzulo and Liliana Sferco for parasite cultures. Dr. Keith Gull is greatly acknowledged for the L1C6 antibody. pTEX-eGFP was kindly provided by Dr. J.M. Kelly. We are also indebted to Nicolas Mendiondo (from our lab) for sharing the cell line expressing TcSR62 in T. brucei. D.O.S. is a career investigator and E.N. is a fellow from Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET).
Author Contributions
Conceived and designed the experiments: EN DOS. Performed the experiments: EN. Analyzed the data: EN DOS. Contributed reagents/materials/analysis tools: DOS. Wrote the paper: EN DOS.
Citation: Názer E, Sánchez DO (2011) Nucleolar Accumulation of RNA Binding Proteins Induced by ActinomycinD Is Functional in Trypanosoma cruzi and Leishmania mexicana but Not in T. brucei. PLoS ONE 6(8): e24184. https://doi.org/10.1371/journal.pone.0024184
1. Barrett MP, Burchmore RJ, Stich A, Lazzari JO, Frasch AC, et al. (2003) The trypanosomiases. Lancet 362: 1469–1480.MP BarrettRJ BurchmoreA. StichJO LazzariAC Frasch2003The trypanosomiases.Lancet36214691480
2. Clayton C, Shapira M (2007) Post-transcriptional regulation of gene expression in trypanosomes and leishmanias. Mol Biochem Parasitol 156: 93–101.C. ClaytonM. Shapira2007Post-transcriptional regulation of gene expression in trypanosomes and leishmanias.Mol Biochem Parasitol15693101
3. Lee MG, Van der Ploeg LH (1997) Transcription of protein-coding genes in trypanosomes by RNA polymerase I. Annu Rev Microbiol 51: 463–489.MG LeeLH Van der Ploeg1997Transcription of protein-coding genes in trypanosomes by RNA polymerase I.Annu Rev Microbiol51463489
4. Vanhamme L, Pays E (1995) Control of gene expression in trypanosomes. Microbiol Rev 59: 223–240.L. VanhammeE. Pays1995Control of gene expression in trypanosomes.Microbiol Rev59223240
5. Kollien AH, Schaub GA (2000) The development of Trypanosoma cruzi in triatominae. Parasitol Today 16: 381–387.AH KollienGA Schaub2000The development of Trypanosoma cruzi in triatominae.Parasitol Today16381387
6. Rolin S, Hancocq-Quertier J, Paturiaux-Hanocq F, Nolan DP, Pays E (1998) Mild acid stress as a differentiation trigger in Trypanosoma brucei. Mol Biochem Parasitol 93: 251–262.S. RolinJ. Hancocq-QuertierF. Paturiaux-HanocqDP NolanE. Pays1998Mild acid stress as a differentiation trigger in Trypanosoma brucei.Mol Biochem Parasitol93251262
7. Krieger MA, Avila AR, Ogatta SF, Plazanet-Menut C, Goldenberg S (1999) Differential gene expression during Trypanosoma cruzi metacyclogenesis. Mem Inst Oswaldo Cruz 94: Suppl 1165–168.MA KriegerAR AvilaSF OgattaC. Plazanet-MenutS. Goldenberg1999Differential gene expression during Trypanosoma cruzi metacyclogenesis.Mem Inst Oswaldo Cruz94Suppl 1165168
8. Cassola A, De Gaudenzi JG, Frasch AC (2007) Recruitment of mRNAs to cytoplasmic ribonucleoprotein granules in trypanosomes. Mol Microbiol 65: 655–670.A. CassolaJG De GaudenziAC Frasch2007Recruitment of mRNAs to cytoplasmic ribonucleoprotein granules in trypanosomes.Mol Microbiol65655670
9. Kramer S, Queiroz R, Ellis L, Webb H, Hoheisel JD, et al. (2008) Heat shock causes a decrease in polysomes and the appearance of stress granules in trypanosomes independently of eIF2(alpha) phosphorylation at Thr169. J Cell Sci 121: 3002–3014.S. KramerR. QueirozL. EllisH. WebbJD Hoheisel2008Heat shock causes a decrease in polysomes and the appearance of stress granules in trypanosomes independently of eIF2(alpha) phosphorylation at Thr169.J Cell Sci12130023014
10. Nazer E, Verdun RE, Sanchez DO (2011) Nucleolar Localization of RNA Binding Proteins Induced by Actinomycin D and Heat Shock in Trypanosoma cruzi. PLoS One 6: e19920.E. NazerRE VerdunDO Sanchez2011Nucleolar Localization of RNA Binding Proteins Induced by Actinomycin D and Heat Shock in Trypanosoma cruzi.PLoS One6e19920
11. Boisvert FM, van Koningsbruggen S, Navascues J, Lamond AI (2007) The multifunctional nucleolus. Nat Rev Mol Cell Biol 8: 574–585.FM BoisvertS. van KoningsbruggenJ. NavascuesAI Lamond2007The multifunctional nucleolus.Nat Rev Mol Cell Biol8574585
12. Rubbi CP, Milner J (2003) Disruption of the nucleolus mediates stabilization of p53 in response to DNA damage and other stresses. Embo J 22: 6068–6077.CP RubbiJ. Milner2003Disruption of the nucleolus mediates stabilization of p53 in response to DNA damage and other stresses.Embo J2260686077
13. Olson MO (2004) Sensing cellular stress: another new function for the nucleolus? Sci STKE 2004: pe10.MO Olson2004Sensing cellular stress: another new function for the nucleolus?Sci STKE2004pe10
14. Karni-Schmidt O, Zupnick A, Castillo M, Ahmed A, Matos T, et al. (2008) p53 is localized to a sub-nucleolar compartment after proteasomal inhibition in an energy-dependent manner. J Cell Sci 121: 4098–4105.O. Karni-SchmidtA. ZupnickM. CastilloA. AhmedT. Matos2008p53 is localized to a sub-nucleolar compartment after proteasomal inhibition in an energy-dependent manner.J Cell Sci12140984105
15. Koroleva OA, Brown JW, Shaw PJ (2009) Localization of eIF4A-III in the nucleolus and splicing speckles is an indicator of plant stress. Plant Signal Behav 4: 1148–1151.OA KorolevaJW BrownPJ Shaw2009Localization of eIF4A-III in the nucleolus and splicing speckles is an indicator of plant stress.Plant Signal Behav411481151
16. Sydorskyy Y, Srikumar T, Jeram SM, Wheaton S, Vizeacoumar FJ, et al. (2010) A novel mechanism for SUMO system control: regulated Ulp1 nucleolar sequestration. Mol Cell Biol 30: 4452–4462.Y. SydorskyyT. SrikumarSM JeramS. WheatonFJ Vizeacoumar2010A novel mechanism for SUMO system control: regulated Ulp1 nucleolar sequestration.Mol Cell Biol3044524462
17. Wsierska-Gadek J, Horky M (2003) How the nucleolar sequestration of p53 protein or its interplayers contributes to its (re)-activation. Ann N Y Acad Sci 1010: 266–272.J. Wsierska-GadekM. Horky2003How the nucleolar sequestration of p53 protein or its interplayers contributes to its (re)-activation.Ann N Y Acad Sci1010266272
18. Sakashita E, Endo H (2010) SR and SR-related proteins redistribute to segregated fibrillar components of nucleoli in a response to DNA damage. Nucleus 1: 367–380.E. SakashitaH. Endo2010SR and SR-related proteins redistribute to segregated fibrillar components of nucleoli in a response to DNA damage.Nucleus1367380
19. Carmo-Fonseca M, Mendes-Soares L, Campos I (2000) To be or not to be in the nucleolus. Nat Cell Biol 2: E107–112.M. Carmo-FonsecaL. Mendes-SoaresI. Campos2000To be or not to be in the nucleolus.Nat Cell Biol2E107112
20. Andersen JS, Lyon CE, Fox AH, Leung AK, Lam YW, et al. (2002) Directed proteomic analysis of the human nucleolus. Curr Biol 12: 1–11.JS AndersenCE LyonAH FoxAK LeungYW Lam2002Directed proteomic analysis of the human nucleolus.Curr Biol12111
21. Andersen JS, Lam YW, Leung AK, Ong SE, Lyon CE, et al. (2005) Nucleolar proteome dynamics. Nature 433: 77–83.JS AndersenYW LamAK LeungSE OngCE Lyon2005Nucleolar proteome dynamics.Nature4337783
22. Brown JW, Shaw PJ, Shaw P, Marshall DF (2005) Arabidopsis nucleolar protein database (AtNoPDB). Nucleic Acids Res 33: D633–636.JW BrownPJ ShawP. ShawDF Marshall2005Arabidopsis nucleolar protein database (AtNoPDB).Nucleic Acids Res33D633636
23. Mangus DA, Evans MC, Jacobson A (2003) Poly(A)-binding proteins: multifunctional scaffolds for the post-transcriptional control of gene expression. Genome Biol 4: 223.DA MangusMC EvansA. Jacobson2003Poly(A)-binding proteins: multifunctional scaffolds for the post-transcriptional control of gene expression.Genome Biol4223
24. Gorgoni B, Gray NK (2004) The roles of cytoplasmic poly(A)-binding proteins in regulating gene expression: a developmental perspective. Brief Funct Genomic Proteomic 3: 125–141.B. GorgoniNK Gray2004The roles of cytoplasmic poly(A)-binding proteins in regulating gene expression: a developmental perspective.Brief Funct Genomic Proteomic3125141
25. Mishra KK, Holzer TR, Moore LL, LeBowitz JH (2003) A negative regulatory element controls mRNA abundance of the Leishmania mexicana Paraflagellar rod gene PFR2. Eukaryot Cell 2: 1009–1017.KK MishraTR HolzerLL MooreJH LeBowitz2003A negative regulatory element controls mRNA abundance of the Leishmania mexicana Paraflagellar rod gene PFR2.Eukaryot Cell210091017
26. Schwede A, Manful T, Jha BA, Helbig C, Bercovich N, et al. (2009) The role of deadenylation in the degradation of unstable mRNAs in trypanosomes. Nucleic Acids Res 37: 5511–5528.A. SchwedeT. ManfulBA JhaC. HelbigN. Bercovich2009The role of deadenylation in the degradation of unstable mRNAs in trypanosomes.Nucleic Acids Res3755115528
27. Manger ID, Boothroyd JC (1998) Identification of a nuclear protein in Trypanosoma brucei with homology to RNA-binding proteins from cis-splicing systems. Mol Biochem Parasitol 97: 1–11.ID MangerJC Boothroyd1998Identification of a nuclear protein in Trypanosoma brucei with homology to RNA-binding proteins from cis-splicing systems.Mol Biochem Parasitol97111
28. da Costa Lima TD, Moura DM, Reis CR, Vasconcelos JR, Ellis L, et al. (2010) Functional characterization of three leishmania poly(a) binding protein homologues with distinct binding properties to RNA and protein partners. Eukaryot Cell 9: 1484–1494.TD da Costa LimaDM MouraCR ReisJR VasconcelosL. Ellis2010Functional characterization of three leishmania poly(a) binding protein homologues with distinct binding properties to RNA and protein partners.Eukaryot Cell914841494
29. Kelly JM, Ward HM, Miles MA, Kendall G (1992) A shuttle vector which facilitates the expression of transfected genes in Trypanosoma cruzi and Leishmania. Nucleic Acids Res 20: 3963–3969.JM KellyHM WardMA MilesG. Kendall1992A shuttle vector which facilitates the expression of transfected genes in Trypanosoma cruzi and Leishmania.Nucleic Acids Res2039633969
30. Misteli T, Caceres JF, Spector DL (1997) The dynamics of a pre-mRNA splicing factor in living cells. Nature 387: 523–527.T. MisteliJF CaceresDL Spector1997The dynamics of a pre-mRNA splicing factor in living cells.Nature387523527
31. Ali GS, Golovkin M, Reddy AS (2003) Nuclear localization and in vivo dynamics of a plant-specific serine/arginine-rich protein. Plant J 36: 883–893.GS AliM. GolovkinAS Reddy2003Nuclear localization and in vivo dynamics of a plant-specific serine/arginine-rich protein.Plant J36883893
32. Tillemans V, Dispa L, Remacle C, Collinge M, Motte P (2005) Functional distribution and dynamics of Arabidopsis SR splicing factors in living plant cells. Plant J 41: 567–582.V. TillemansL. DispaC. RemacleM. CollingeP. Motte2005Functional distribution and dynamics of Arabidopsis SR splicing factors in living plant cells.Plant J41567582
33. Ullu E, Tschudi C, Chakraborty T (2004) RNA interference in protozoan parasites. Cell Microbiol 6: 509–519.E. UlluC. TschudiT. Chakraborty2004RNA interference in protozoan parasites.Cell Microbiol6509519
34. DaRocha WD, Otsu K, Teixeira SM, Donelson JE (2004) Tests of cytoplasmic RNA interference (RNAi) and construction of a tetracycline-inducible T7 promoter system in Trypanosoma cruzi. Mol Biochem Parasitol 133: 175–186.WD DaRochaK. OtsuSM TeixeiraJE Donelson2004Tests of cytoplasmic RNA interference (RNAi) and construction of a tetracycline-inducible T7 promoter system in Trypanosoma cruzi.Mol Biochem Parasitol133175186
35. Lye LF, Owens K, Shi H, Murta SM, Vieira AC, et al. (2010) Retention and loss of RNA interference pathways in trypanosomatid protozoans. PLoS Pathog 6: e1001161.LF LyeK. OwensH. ShiSM MurtaAC Vieira2010Retention and loss of RNA interference pathways in trypanosomatid protozoans.PLoS Pathog6e1001161
You have requested "on-the-fly" machine translation of selected content from our databases. This functionality is provided solely for your convenience and is in no way intended to replace human translation. Show full disclaimer
Neither ProQuest nor its licensors make any representations or warranties with respect to the translations. The translations are automatically generated "AS IS" and "AS AVAILABLE" and are not retained in our systems. PROQUEST AND ITS LICENSORS SPECIFICALLY DISCLAIM ANY AND ALL EXPRESS OR IMPLIED WARRANTIES, INCLUDING WITHOUT LIMITATION, ANY WARRANTIES FOR AVAILABILITY, ACCURACY, TIMELINESS, COMPLETENESS, NON-INFRINGMENT, MERCHANTABILITY OR FITNESS FOR A PARTICULAR PURPOSE. Your use of the translations is subject to all use restrictions contained in your Electronic Products License Agreement and by using the translation functionality you agree to forgo any and all claims against ProQuest or its licensors for your use of the translation functionality and any output derived there from. Hide full disclaimer
© 2011 Názer, Sánchez. This is an open-access article distributed under the terms of the Creative Commons Attribution License: https://creativecommons.org/licenses/by/4.0/ (the “License”), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Notwithstanding the ProQuest Terms and Conditions, you may use this content in accordance with the terms of the License.
Abstract
We have recently shown in T. cruzi that a group of RNA Binding Proteins (RBPs), involved in mRNA metabolism, are accumulated into the nucleolus in response to Actinomycin D (ActD) treatment. In this work, we have extended our analysis to other members of the trypanosomatid lineage. In agreement with our previous study, the mechanism seems to be conserved in L. mexicana, since both endogenous RBPs and a transgenic RBP were relocalized to the nucleolus in parasites exposed to ActD. In contrast, in T. brucei, neither endogenous RBPs (TbRRM1 and TbPABP2) nor a transgenic RBP from T. cruzi were accumulated into the nucleolus under such treatment. Interestingly, when a transgenic TbRRM1was expressed in T. cruzi and the parasites exposed to ActD, TbRRM1 relocated to the nucleolus, suggesting that it contains the necessary sequence elements to be targeted to the nucleolus. Together, both experiments demonstrate that the mechanism behind nucleolar localization of RBPs, which is present in T. cruzi and L. mexicana, is not functional in T. brucei, suggesting that it has been lost or retained differentially during the evolution of the trypanosomatid lineage.
You have requested "on-the-fly" machine translation of selected content from our databases. This functionality is provided solely for your convenience and is in no way intended to replace human translation. Show full disclaimer
Neither ProQuest nor its licensors make any representations or warranties with respect to the translations. The translations are automatically generated "AS IS" and "AS AVAILABLE" and are not retained in our systems. PROQUEST AND ITS LICENSORS SPECIFICALLY DISCLAIM ANY AND ALL EXPRESS OR IMPLIED WARRANTIES, INCLUDING WITHOUT LIMITATION, ANY WARRANTIES FOR AVAILABILITY, ACCURACY, TIMELINESS, COMPLETENESS, NON-INFRINGMENT, MERCHANTABILITY OR FITNESS FOR A PARTICULAR PURPOSE. Your use of the translations is subject to all use restrictions contained in your Electronic Products License Agreement and by using the translation functionality you agree to forgo any and all claims against ProQuest or its licensors for your use of the translation functionality and any output derived there from. Hide full disclaimer




